GLP2R Rabbit Polyclonal Antibody

GLP2R Rabbit Polyclonal Antibody

Contact Us Below To Order :

GLP2R Rabbit pAb
A6602-100ul	Abclonal	100 ul	EUR 308

GLP2R Rabbit pAb
A6602-200ul	Abclonal	200 ul	EUR 459

GLP2R Rabbit pAb
A6602-20ul	Abclonal	20 ul	EUR 183

GLP2R Rabbit pAb
A6602-50ul	Abclonal	50 ul	EUR 223

Polyclonal GLP2R Antibody (Internal)
APR01964G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GLP2R (Internal). This antibody is tested and proven to work in the following applications:

GLP2R antibody
39037-100ul	SAB	100ul	EUR 252

GLP2R Antibody
43319-100ul	SAB	100ul	EUR 252

GLP2R Antibody
DF10216	Affbiotech	200ul	EUR 304
Description: GLP2R Antibody detects endogenous levels of total GLP2R.

GLP2R Antibody
1-CSB-PA286159	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GLP2R. Recognizes GLP2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

GLP2R antibody
70R-5959	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GLP2R antibody raised against the N terminal of GLP2R

GLP2R Antibody
1-CSB-PA025580	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GLP2R. Recognizes GLP2R from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

GLP2R Antibody
1-CSB-PA009515ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GLP2R. Recognizes GLP2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GLP2R Antibody
ABD10216	Lifescience Market	100 ug	EUR 438

Polyclonal GLP2R Antibody (C-Terminus)
APR01965G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GLP2R (C-Terminus). This antibody is tested and proven to work in the following applications:

Glp2r/ Rat Glp2r ELISA Kit
ELI-43481r	Lifescience Market	96 Tests	EUR 886

GLP2R Conjugated Antibody
C39037	SAB	100ul	EUR 397

Anti-GLP2R antibody
STJ28685	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a G protein-coupled receptor that is closely related to the glucagon receptor and binds to glucagon-like peptide-2 (GLP2). Signalling through GLP2 stimulates intestinal growth and increases villus height in the small intestine, concomitant with increased crypt cell proliferation and decreased enterocyte apoptosis.

Anti-GLP2R Antibody
STJ501181	St John's Laboratory	100 µg	EUR 476

Anti-GLP2R antibody
STJ192649	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GLP2R

GLP2R siRNA
20-abx902184	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GLP2R siRNA
20-abx918019	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GLP2R siRNA
20-abx918020	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-GLP2R
YF-PA25313	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to GLP2R

Anti-GLP2R Antibody BIOTIN
STJ501182	St John's Laboratory	100 µg	EUR 586

Anti-GLP2R Antibody FITC
STJ501183	St John's Laboratory	100 µg	EUR 586

GLP2R Blocking Peptide
33R-4510	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GLP2R antibody, catalog no. 70R-5959

GLP2R Blocking Peptide
DF10216-BP	Affbiotech	1mg	EUR 195

GLP2R cloning plasmid
CSB-CL009515HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1662 Sequence: ATGAAGCTGGGATCGAGCAGGGCAGGGCCTGGGAGAGGAAGCGCGGGACTCCTGCCTGGCGTCCACGAGCTGCCCATGGGCATCCCTGCCCCCTGGGGGACCAGTCCTCTCTCCTTCCACAGGAAGTGCTCTCTCTGGGCCCCTGGGAGGCCCTTCCTCACTCTGGTCCTGCTGG Show more
Description: A cloning plasmid for the GLP2R gene.

Anti-GLP2R (1F2)
YF-MA16783	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GLP2R

GLP2R ELISA KIT|Human
EF005042	Lifescience Market	96 Tests	EUR 689

Rat GLP2R shRNA Plasmid
20-abx986050	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GLP2R shRNA Plasmid
20-abx956181	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GLP2R shRNA Plasmid
20-abx979251	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GLP2R Recombinant Protein (Human)
RP039493	ABM	100 ug	Ask for price

GLP2R Recombinant Protein (Rat)
RP202799	ABM	100 ug	Ask for price

GLP2R Recombinant Protein (Mouse)
RP136721	ABM	100 ug	Ask for price

Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody
20-abx005063	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody
20-abx005620	Abbexa	EUR 411.00 EUR 592.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody
abx215627-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody
20-abx213173	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody
20-abx210518	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody
20-abx320784	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Monoclonal GLP2R Antibody (monoclonal) (M05), Clone: 1F2
AMM03584G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human GLP2R (monoclonal) (M05). The antibodies are raised in mouse and are from clone 1F2. This antibody is applicable in WB, E

Glp2r ORF Vector (Rat) (pORF)
ORF067601	ABM	1.0 ug DNA	EUR 506

GLP2R ORF Vector (Human) (pORF)
ORF013165	ABM	1.0 ug DNA	EUR 354

Glp2r ORF Vector (Mouse) (pORF)
ORF045575	ABM	1.0 ug DNA	EUR 506

pECMV-Glp2r-m-FLAG Plasmid
PVT15234	Lifescience Market	2 ug	EUR 325

GLP2R ELISA Kit (Rat) (OKEH08217)
OKEH08217	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: proglucagon-derived peptide involved in the regulation of energy homeostasis via effects on nutrient absorption and maintenance of gut mucosal epithelial integrity and may also play a role in the central nervous system [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

GLP2R ELISA Kit (Human) (OKEI00296)
OKEI00296	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: This is a receptor for glucagon-like peptide 2. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

GLP2R ELISA Kit (Rat) (OKWB00388)
OKWB00388	Aviva Systems Biology	96 Wells	EUR 572
Description: Description of target: This is a receptor for glucagon-like peptide 2. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase. ;Species reactivity: Rat;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL

Glp2r sgRNA CRISPR Lentivector set (Rat)
K6909201	ABM	3 x 1.0 ug	EUR 339

Glp2r sgRNA CRISPR Lentivector set (Mouse)
K4372401	ABM	3 x 1.0 ug	EUR 339

GLP2R sgRNA CRISPR Lentivector set (Human)
K0867201	ABM	3 x 1.0 ug	EUR 339

Glp2r sgRNA CRISPR Lentivector (Rat) (Target 1)
K6909202	ABM	1.0 ug DNA	EUR 154

Glp2r sgRNA CRISPR Lentivector (Rat) (Target 2)
K6909203	ABM	1.0 ug DNA	EUR 154

Glp2r sgRNA CRISPR Lentivector (Rat) (Target 3)
K6909204	ABM	1.0 ug DNA	EUR 154

Glp2r sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4372402	ABM	1.0 ug DNA	EUR 154

Glp2r sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4372403	ABM	1.0 ug DNA	EUR 154

Glp2r sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4372404	ABM	1.0 ug DNA	EUR 154

GLP2R sgRNA CRISPR Lentivector (Human) (Target 1)
K0867202	ABM	1.0 ug DNA	EUR 154

GLP2R sgRNA CRISPR Lentivector (Human) (Target 2)
K0867203	ABM	1.0 ug DNA	EUR 154

GLP2R sgRNA CRISPR Lentivector (Human) (Target 3)
K0867204	ABM	1.0 ug DNA	EUR 154

GLP2R Protein Vector (Rat) (pPB-C-His)
PV270402	ABM	500 ng	EUR 603

GLP2R Protein Vector (Rat) (pPB-N-His)
PV270403	ABM	500 ng	EUR 603

GLP2R Protein Vector (Rat) (pPM-C-HA)
PV270404	ABM	500 ng	EUR 603

GLP2R Protein Vector (Rat) (pPM-C-His)
PV270405	ABM	500 ng	EUR 603

GLP2R Protein Vector (Mouse) (pPB-C-His)
PV182298	ABM	500 ng	EUR 603

GLP2R Protein Vector (Mouse) (pPB-N-His)
PV182299	ABM	500 ng	EUR 603

GLP2R Protein Vector (Mouse) (pPM-C-HA)
PV182300	ABM	500 ng	EUR 603

GLP2R Protein Vector (Mouse) (pPM-C-His)
PV182301	ABM	500 ng	EUR 603

GLP2R Protein Vector (Human) (pPB-C-His)
PV052657	ABM	500 ng	EUR 481

GLP2R Protein Vector (Human) (pPB-N-His)
PV052658	ABM	500 ng	EUR 481

GLP2R Protein Vector (Human) (pPM-C-HA)
PV052659	ABM	500 ng	EUR 481

GLP2R Protein Vector (Human) (pPM-C-His)
PV052660	ABM	500 ng	EUR 481

GLP2R Rabbit Polyclonal Antibody