IGKC Rabbit Polyclonal Antibody

IGKC Rabbit Polyclonal Antibody

Contact Us Below To Order :

    IGKC Polyclonal Antibody

    ABP58905-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human IGKC protein
    • Applications tips:
    Description: A polyclonal antibody for detection of IGKC from Human. This IGKC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IGKC protein

    IGKC Polyclonal Antibody

    ES11846-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against IGKC from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    IGKC Polyclonal Antibody

    ES11846-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against IGKC from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    IGKC Antibody

    1-CSB-PA011340LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

    Anti-IGKC antibody

    STJ193004 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to IGKC

    IGKC Antibody, HRP conjugated

    1-CSB-PA011340LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    IGKC Antibody, FITC conjugated

    1-CSB-PA011340LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    IGKC Antibody, Biotin conjugated

    1-CSB-PA011340LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    IGKC cloning plasmid

    CSB-CL011340HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 705
    • Sequence: atgagggtccccgctcagctcctggggctcctgctgctctggctcccaggtgccagatgtgccatccggatgacccagtctccatcctcattctctgcatctacaggagacagagtcaccatcacttgtcgggcgagtcagagtattggtagttatttagcctggtatcagcaaaa
    • Show more
    Description: A cloning plasmid for the IGKC gene.

    IGKC cloning plasmid

    CSB-CL011340HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 711
    • Sequence: atggacatgagggtcccctctcagctcctggggctcctgctgctctggctcccaggtgccagatgtgacatccagttgacccagtctccatccttcctgtctgcatctgtaggagacagagtcaccatcacttgccgggccagtcagggcattagcagttatttagcctggtatca
    • Show more
    Description: A cloning plasmid for the IGKC gene.

    IGKC cloning plasmid

    CSB-CL011340HU3-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 714
    • Sequence: atggacatgagggtccccgctcagctcctggggctcctgctgctctggttcccaggttccagatgcgacatccacatgacccagtctccatcttctgtgtctgcatctgtaggagacagagtcaccatcacctgtcgggcgagtcagcgtattagcagcagctggttagcctggta
    • Show more
    Description: A cloning plasmid for the IGKC gene.

    IGKC cloning plasmid

    CSB-CL011340HU4-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 723
    • Sequence: ATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCCCAGGATCCAGTGGGGATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTATACAGTGATGGAAACACCTACTTGAA
    • Show more
    Description: A cloning plasmid for the IGKC gene.

    IGKC Recombinant Protein (Human)

    RP015805 100 ug Ask for price

    IGKC Recombinant Protein (Human)

    RP015808 100 ug Ask for price

    IGKC Recombinant Protein (Human)

    RP015811 100 ug Ask for price

    IGKC Recombinant Protein (Human)

    RP040006 100 ug Ask for price

    IGKC ORF Vector (Human) (pORF)

    ORF005269 1.0 ug DNA
    EUR 95

    IGKC ORF Vector (Human) (pORF)

    ORF005270 1.0 ug DNA
    EUR 95

    IGKC ORF Vector (Human) (pORF)

    ORF005271 1.0 ug DNA
    EUR 95

    IGKC ORF Vector (Human) (pORF)

    ORF013336 1.0 ug DNA
    EUR 354

    Kappa Light Chain/ IGKC MonoSpecific Antibody, Unconjugated-20ug

    3514-MSM10-P0 20ug
    EUR 233

    Kappa Light Chain/ IGKC MonoSpecific Antibody, Unconjugated-100ug

    3514-MSM10-P1 100ug
    EUR 428

    IGKC sgRNA CRISPR Lentivector set (Human)

    K1049801 3 x 1.0 ug
    EUR 339

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNCR2289-250 250uL
    EUR 394
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), RPE conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNUB1999-100 100uL
    EUR 264
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Concentration: 0.2mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNUB1999-50 50uL
    EUR 405
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), 1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNUB1999-500 500uL
    EUR 513
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Concentration: 0.2mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNUB2050-100 100uL
    EUR 264
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Concentration: 0.2mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNUB2050-50 50uL
    EUR 405
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), 1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNUB2050-500 500uL
    EUR 513
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Concentration: 0.2mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNUB2289-100 100uL
    EUR 264
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Concentration: 0.2mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNUB2289-50 50uL
    EUR 405
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), 1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNUB2289-500 500uL
    EUR 513
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Concentration: 0.2mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC551999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF555 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC551999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF555 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC552050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF555 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC552050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF555 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC552289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF555 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC552289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF555 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC611999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF660R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC611999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF660R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC612050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF660R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC612050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF660R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC432289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF543 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC432289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF543 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC471999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF647 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC471999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF647 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC472050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF647 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC472050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF647 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC472289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF647 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC472289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF647 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC041999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405S conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC041999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405S conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC042050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405S conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC042050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405S conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC042289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405S conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC042289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405S conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC051999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405M conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC051999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405M conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC052050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405M conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC052050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405M conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC052289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405M conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC052289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405M conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC401999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF640R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC401999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF640R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC402050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF640R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC402050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF640R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC402289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF640R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC402289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF640R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC431999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF543 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC431999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF543 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC432050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF543 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC432050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF543 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC701999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF770 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC701999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF770 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC702050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF770 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC702050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF770 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC702289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF770 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC702289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF770 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC801999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF680 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC801999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF680 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC802050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF680 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC802050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF680 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC802289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF680 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC802289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF680 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNCH1999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNCH1999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNCH2050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNCH2050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNCH2289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNCH2289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNCP1999-250 250uL
    EUR 394
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), PerCP conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNCP2050-250 250uL
    EUR 394
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), PerCP conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNCP2289-250 250uL
    EUR 394
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), PerCP conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNCR1999-250 250uL
    EUR 394
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), RPE conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNCR2050-250 250uL
    EUR 394
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), RPE conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC941999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF594 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC941999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF594 conjugate, Concentration: 0.1mg/mL

    IGKC Rabbit Polyclonal Antibody