IGKC Rabbit Polyclonal Antibody

IGKC Rabbit Polyclonal Antibody

Contact Us Below To Order :

    IGKC Polyclonal Antibody

    ABP58905-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human IGKC protein
    • Applications tips:
    Description: A polyclonal antibody for detection of IGKC from Human. This IGKC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IGKC protein

    IGKC Polyclonal Antibody

    ES11846-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against IGKC from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    IGKC Polyclonal Antibody

    ES11846-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against IGKC from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    IGKC Antibody

    1-CSB-PA011340LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

    Anti-IGKC antibody

    STJ193004 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to IGKC

    IGKC Antibody, HRP conjugated

    1-CSB-PA011340LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    IGKC Antibody, FITC conjugated

    1-CSB-PA011340LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    IGKC Antibody, Biotin conjugated

    1-CSB-PA011340LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    IGKC cloning plasmid

    CSB-CL011340HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 705
    • Sequence: atgagggtccccgctcagctcctggggctcctgctgctctggctcccaggtgccagatgtgccatccggatgacccagtctccatcctcattctctgcatctacaggagacagagtcaccatcacttgtcgggcgagtcagagtattggtagttatttagcctggtatcagcaaaa
    • Show more
    Description: A cloning plasmid for the IGKC gene.

    IGKC cloning plasmid

    CSB-CL011340HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 711
    • Sequence: atggacatgagggtcccctctcagctcctggggctcctgctgctctggctcccaggtgccagatgtgacatccagttgacccagtctccatccttcctgtctgcatctgtaggagacagagtcaccatcacttgccgggccagtcagggcattagcagttatttagcctggtatca
    • Show more
    Description: A cloning plasmid for the IGKC gene.

    IGKC cloning plasmid

    CSB-CL011340HU3-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 714
    • Sequence: atggacatgagggtccccgctcagctcctggggctcctgctgctctggttcccaggttccagatgcgacatccacatgacccagtctccatcttctgtgtctgcatctgtaggagacagagtcaccatcacctgtcgggcgagtcagcgtattagcagcagctggttagcctggta
    • Show more
    Description: A cloning plasmid for the IGKC gene.

    IGKC cloning plasmid

    CSB-CL011340HU4-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 723
    • Sequence: ATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCCCAGGATCCAGTGGGGATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTATACAGTGATGGAAACACCTACTTGAA
    • Show more
    Description: A cloning plasmid for the IGKC gene.

    IGKC Recombinant Protein (Human)

    RP015805 100 ug Ask for price

    IGKC Recombinant Protein (Human)

    RP015808 100 ug Ask for price

    IGKC Recombinant Protein (Human)

    RP015811 100 ug Ask for price

    IGKC Recombinant Protein (Human)

    RP040006 100 ug Ask for price

    IGKC ORF Vector (Human) (pORF)

    ORF005269 1.0 ug DNA
    EUR 95

    IGKC ORF Vector (Human) (pORF)

    ORF005270 1.0 ug DNA
    EUR 95

    IGKC ORF Vector (Human) (pORF)

    ORF005271 1.0 ug DNA
    EUR 95

    IGKC ORF Vector (Human) (pORF)

    ORF013336 1.0 ug DNA
    EUR 354

    Kappa Light Chain/ IGKC MonoSpecific Antibody, Unconjugated-20ug

    3514-MSM10-P0 20ug
    EUR 233

    Kappa Light Chain/ IGKC MonoSpecific Antibody, Unconjugated-100ug

    3514-MSM10-P1 100ug
    EUR 428

    IGKC sgRNA CRISPR Lentivector set (Human)

    K1049801 3 x 1.0 ug
    EUR 339

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNCR2289-250 250uL
    EUR 394
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), RPE conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNUB1999-100 100uL
    EUR 264
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Concentration: 0.2mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNUB1999-50 50uL
    EUR 405
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), 1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNUB1999-500 500uL
    EUR 513
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Concentration: 0.2mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNUB2050-100 100uL
    EUR 264
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Concentration: 0.2mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNUB2050-50 50uL
    EUR 405
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), 1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNUB2050-500 500uL
    EUR 513
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Concentration: 0.2mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNUB2289-100 100uL
    EUR 264
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Concentration: 0.2mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNUB2289-50 50uL
    EUR 405
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), 1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNUB2289-500 500uL
    EUR 513
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Concentration: 0.2mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC551999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF555 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC551999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF555 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC552050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF555 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC552050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF555 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC552289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF555 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC552289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF555 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC611999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF660R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC611999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF660R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC612050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF660R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC612050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF660R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC432289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF543 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC432289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF543 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC471999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF647 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC471999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF647 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC472050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF647 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC472050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF647 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC472289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF647 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC472289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF647 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC041999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405S conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC041999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405S conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC042050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405S conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC042050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405S conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC042289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405S conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC042289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405S conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC051999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405M conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC051999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405M conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC052050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405M conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC052050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405M conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC052289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405M conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC052289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405M conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC401999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF640R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC401999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF640R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC402050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF640R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC402050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF640R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC402289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF640R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC402289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF640R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC431999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF543 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC431999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF543 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC432050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF543 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC432050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF543 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC701999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF770 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC701999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF770 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC702050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF770 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC702050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF770 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC702289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF770 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC702289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF770 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC801999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF680 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC801999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF680 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC802050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF680 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC802050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF680 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC802289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF680 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC802289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF680 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNCH1999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNCH1999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNCH2050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNCH2050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNCH2289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNCH2289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNCP1999-250 250uL
    EUR 394
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), PerCP conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNCP2050-250 250uL
    EUR 394
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), PerCP conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNCP2289-250 250uL
    EUR 394
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), PerCP conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNCR1999-250 250uL
    EUR 394
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), RPE conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNCR2050-250 250uL
    EUR 394
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), RPE conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC941999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF594 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC941999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF594 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC942050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF594 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC942050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF594 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC942289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF594 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC942289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF594 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNCA1999-250 250uL
    EUR 394
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), APC conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNCA2050-250 250uL
    EUR 394
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), APC conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNCA2289-250 250uL
    EUR 394
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), APC conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNCB1999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Biotin conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNCB1999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Biotin conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNCB2050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Biotin conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNCB2050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Biotin conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNCB2289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Biotin conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNCB2289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Biotin conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC881999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF488A conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC881999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF488A conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC882050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF488A conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC882050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF488A conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC882289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF488A conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC882289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF488A conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC681999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF568 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC681999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF568 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC682050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF568 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC682050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF568 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC682289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF568 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC682289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF568 conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNCAP1999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNCAP1999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNCAP2050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNCAP2050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNCAP2289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNCAP2289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC811999-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF680R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody

    BNC811999-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF680R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC812050-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF680R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody

    BNC812050-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF680R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC812289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF680R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC812289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF680R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC612289-100 100uL
    EUR 233
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF660R conjugate, Concentration: 0.1mg/mL

    Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody

    BNC612289-500 500uL
    EUR 545
    Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF660R conjugate, Concentration: 0.1mg/mL

    IGKC sgRNA CRISPR Lentivector (Human) (Target 1)

    K1049802 1.0 ug DNA
    EUR 154

    IGKC sgRNA CRISPR Lentivector (Human) (Target 2)

    K1049803 1.0 ug DNA
    EUR 154

    IGKC sgRNA CRISPR Lentivector (Human) (Target 3)

    K1049804 1.0 ug DNA
    EUR 154

    IGKC Protein Vector (Human) (pPB-C-His)

    PV021073 500 ng
    EUR 329

    IGKC Protein Vector (Human) (pPB-N-His)

    PV021074 500 ng
    EUR 329

    IGKC Protein Vector (Human) (pPM-C-HA)

    PV021075 500 ng
    EUR 329

    IGKC Protein Vector (Human) (pPM-C-His)

    PV021076 500 ng
    EUR 329

    IGKC Protein Vector (Human) (pPB-C-His)

    PV021077 500 ng
    EUR 329

    IGKC Protein Vector (Human) (pPB-N-His)

    PV021078 500 ng
    EUR 329

    IGKC Protein Vector (Human) (pPM-C-HA)

    PV021079 500 ng
    EUR 329

    IGKC Protein Vector (Human) (pPM-C-His)

    PV021080 500 ng
    EUR 329

    IGKC Protein Vector (Human) (pPB-C-His)

    PV021081 500 ng
    EUR 329

    IGKC Protein Vector (Human) (pPB-N-His)

    PV021082 500 ng
    EUR 329

    IGKC Protein Vector (Human) (pPM-C-HA)

    PV021083 500 ng
    EUR 329

    IGKC Protein Vector (Human) (pPM-C-His)

    PV021084 500 ng
    EUR 329

    IGKC Protein Vector (Human) (pPB-C-His)

    PV053341 500 ng
    EUR 481

    IGKC Protein Vector (Human) (pPB-N-His)

    PV053342 500 ng
    EUR 481

    IGKC Protein Vector (Human) (pPM-C-HA)

    PV053343 500 ng
    EUR 481

    IGKC Protein Vector (Human) (pPM-C-His)

    PV053344 500 ng
    EUR 481

    IGKC 3'UTR GFP Stable Cell Line

    TU060772 1.0 ml
    EUR 1394

    IGKC 3'UTR Luciferase Stable Cell Line

    TU010772 1.0 ml
    EUR 1394

    GAPDH Rabbit Polyclonal Antibody

    37985-100ul 100ul
    EUR 252

    GAPDH Rabbit Polyclonal Antibody

    37985-50ul 50ul
    EUR 187

    EFHD1 Rabbit Polyclonal Antibody

    38001-100ul 100ul
    EUR 252

    EFHD1 Rabbit Polyclonal Antibody

    38001-50ul 50ul
    EUR 187

    Alliinase Rabbit Polyclonal Antibody

    38042-100ul 100ul
    EUR 252

    Alliinase Rabbit Polyclonal Antibody

    38042-50ul 50ul
    EUR 187

    ECFP Rabbit Polyclonal Antibody

    38077-100ul 100ul
    EUR 252

    ECFP Rabbit Polyclonal Antibody

    38077-50ul 50ul
    EUR 187

    EYFP Rabbit Polyclonal Antibody

    38078-100ul 100ul
    EUR 252

    EYFP Rabbit Polyclonal Antibody

    38078-50ul 50ul
    EUR 187

    mOrange Rabbit Polyclonal Antibody

    38079-100ul 100ul
    EUR 252

    mOrange Rabbit Polyclonal Antibody

    38079-50ul 50ul
    EUR 187

    mStrawberry Rabbit Polyclonal Antibody

    38083-100ul 100ul
    EUR 252

    mStrawberry Rabbit Polyclonal Antibody

    38083-50ul 50ul
    EUR 187

    AmCyan Rabbit Polyclonal Antibody

    38086-100ul 100ul
    EUR 252

    AmCyan Rabbit Polyclonal Antibody

    38086-50ul 50ul
    EUR 187

    EBFP Rabbit Polyclonal Antibody

    38087-100ul 100ul
    EUR 252

    EBFP Rabbit Polyclonal Antibody

    38087-50ul 50ul
    EUR 187

    Vimentin Rabbit Polyclonal Antibody

    38104-100ul 100ul
    EUR 252

    Vimentin Rabbit Polyclonal Antibody

    38104-50ul 50ul
    EUR 187

    LDHD Rabbit Polyclonal Antibody

    38105-100ul 100ul
    EUR 252

    LDHD Rabbit Polyclonal Antibody

    38105-50ul 50ul
    EUR 187

    GAPDH Rabbit Polyclonal Antibody

    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    Rabbit Hemoglobin Polyclonal Antibody

    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Met Rabbit Polyclonal Antibody

    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    VEGF Rabbit Polyclonal Antibody

    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    CD10 Rabbit Polyclonal Antibody

    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    NM23A Rabbit Polyclonal Antibody

    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    ATM Rabbit Polyclonal Antibody

    ABP57463-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57463-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57463-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    JAK1 Rabbit Polyclonal Antibody

    ABP57569-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

    JAK1 Rabbit Polyclonal Antibody

    ABP57569-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

    JAK1 Rabbit Polyclonal Antibody

    ABP57569-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

    JAK2 Rabbit Polyclonal Antibody

    ABP57570-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

    JAK2 Rabbit Polyclonal Antibody

    ABP57570-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

    JAK2 Rabbit Polyclonal Antibody

    ABP57570-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

    JNK2 Rabbit Polyclonal Antibody

    ABP57571-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

    JNK2 Rabbit Polyclonal Antibody

    ABP57571-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

    JNK2 Rabbit Polyclonal Antibody

    ABP57571-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

    JNK3 Rabbit Polyclonal Antibody

    ABP57572-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

    JNK3 Rabbit Polyclonal Antibody

    ABP57572-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

    JNK3 Rabbit Polyclonal Antibody

    ABP57572-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

    MEK2 Rabbit Polyclonal Antibody

    ABP57573-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

    MEK2 Rabbit Polyclonal Antibody

    ABP57573-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

    MEK2 Rabbit Polyclonal Antibody

    ABP57573-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

    MEK3 Rabbit Polyclonal Antibody

    ABP57574-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

    MEK3 Rabbit Polyclonal Antibody

    ABP57574-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

    MEK3 Rabbit Polyclonal Antibody

    ABP57574-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

    Nrf2 Rabbit Polyclonal Antibody

    ABP57575-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

    Nrf2 Rabbit Polyclonal Antibody

    ABP57575-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

    Nrf2 Rabbit Polyclonal Antibody

    ABP57575-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

    ATG4a Rabbit Polyclonal Antibody

    ABP57576-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

    ATG4a Rabbit Polyclonal Antibody

    ABP57576-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

    ATG4a Rabbit Polyclonal Antibody

    ABP57576-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

    ATG4b Rabbit Polyclonal Antibody

    ABP57577-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

    ATG4b Rabbit Polyclonal Antibody

    ABP57577-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

    ATG4b Rabbit Polyclonal Antibody

    ABP57577-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

    ATG4c Rabbit Polyclonal Antibody

    ABP57578-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

    ATG4c Rabbit Polyclonal Antibody

    ABP57578-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

    ATG4c Rabbit Polyclonal Antibody

    ABP57578-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

    ATG5 Rabbit Polyclonal Antibody

    ABP57579-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

    ATG5 Rabbit Polyclonal Antibody

    ABP57579-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

    ATG5 Rabbit Polyclonal Antibody

    ABP57579-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

    ATG7 Rabbit Polyclonal Antibody

    ABP57580-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

    ATG7 Rabbit Polyclonal Antibody

    ABP57580-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

    ATG7 Rabbit Polyclonal Antibody

    ABP57580-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

    ATG13 Rabbit Polyclonal Antibody

    ABP57581-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57581-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57581-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57582-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57582-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57582-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG14L Rabbit Polyclonal Antibody

    ABP57583-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

    IGKC Rabbit Polyclonal Antibody