GPR6 Rabbit Polyclonal Antibody

GPR6 Rabbit Polyclonal Antibody

Contact Us Below To Order :

GPR6 Polyclonal Antibody
ABP58694-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human GPR6 protein at amino acid sequence of 290-370 Applications tips:
Description: A polyclonal antibody for detection of GPR6 from Human, Mouse, Rat. This GPR6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR6 protein at amino acid sequence of 290-370

GPR6 Polyclonal Antibody
ES11476-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GPR6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPR6 Polyclonal Antibody
ES11476-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GPR6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPR6 Rabbit pAb
A14738-100ul	Abclonal	100 ul	EUR 308

GPR6 Rabbit pAb
A14738-200ul	Abclonal	200 ul	EUR 459

GPR6 Rabbit pAb
A14738-20ul	Abclonal	20 ul	EUR 183

GPR6 Rabbit pAb
A14738-50ul	Abclonal	50 ul	EUR 223

GPR6 Rabbit pAb
A2961-100ul	Abclonal	100 ul	EUR 308

GPR6 Rabbit pAb
A2961-200ul	Abclonal	200 ul	EUR 459

GPR6 Rabbit pAb
A2961-20ul	Abclonal	20 ul	Ask for price

GPR6 Rabbit pAb
A2961-50ul	Abclonal	50 ul	EUR 223

GPR6 Antibody
31210-100ul	SAB	100ul	EUR 252

GPR6 Antibody
31210-50ul	SAB	50ul	EUR 187

GPR6 Antibody
DF2754	Affbiotech	200ul	EUR 304
Description: GPR6 antibody detects endogenous levels of total GPR6.

GPR6 Antibody
1-CSB-PA363377	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GPR6. Recognizes GPR6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:10-1:50

GPR6 Antibody
1-CSB-PA197658	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GPR6. Recognizes GPR6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

GPR6 antibody
70R-6934	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GPR6 antibody raised against the N terminal of GPR6

GPR6 Antibody
ABD2754	Lifescience Market	100 ug	EUR 438

Polyclonal GPR6 Antibody (Cytoplasmic Domain)
APR12230G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR6 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR6 antibody - N-terminal region
APR12231G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR6 - N-terminal region. This antibody is tested and proven to work in the following applications:

Gpr6/ Rat Gpr6 ELISA Kit
ELI-27480r	Lifescience Market	96 Tests	EUR 886

GPR6 Conjugated Antibody
C31210	SAB	100ul	EUR 397

Anti-GPR6 antibody
STJ116938	St John's Laboratory	100 µl	EUR 277

Anti-GPR6 antibody
STJ192634	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GPR6

Anti-GPR6 antibody
STJ23844	St John's Laboratory	100 µl	EUR 277

GPR6 siRNA
20-abx902289	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPR6 siRNA
20-abx918551	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPR6 siRNA
20-abx918552	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPR6 Blocking Peptide
33R-6644	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GPR6 antibody, catalog no. 70R-6934

GPR6 Blocking Peptide
DF2754-BP	Affbiotech	1mg	EUR 195

GPR6 cloning plasmid
CSB-CL009822HU1-10ug	Cusabio	10ug	EUR 415
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1089 Sequence: atgaacgcgagcgccgcctcgctcaacgactcccaggtggtggtagtggcggccgaaggagcggcggcggcggccacagcagcaggggggccggacacgggcgaatggggaccccctgctgcggcggctctaggagccggcggcggagctaatgggtctctggagctgtcctcgc Show more
Description: A cloning plasmid for the GPR6 gene.

GPR6 cloning plasmid
CSB-CL009822HU2-10ug	Cusabio	10ug	EUR 415
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1089 Sequence: atgaacgcgagcgccgcctcgctcaacgactcccaggtggtggtagtggcggccgaaggagcggcggcggcggccacagcagcaggggggccggacacgggcgaatggggaccccctgctgcggcggctctaggagccggcggcggagctaatgggtctctggagctgtcctcgc Show more
Description: A cloning plasmid for the GPR6 gene.

Rat GPR6 shRNA Plasmid
20-abx986830	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GPR6 shRNA Plasmid
20-abx951895	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GPR6 shRNA Plasmid
20-abx980268	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GPR6 Recombinant Protein (Human)
RP039586	ABM	100 ug	Ask for price

GPR6 Recombinant Protein (Human)
RP039589	ABM	100 ug	Ask for price

GPR6 Recombinant Protein (Rat)
RP203444	ABM	100 ug	Ask for price

GPR6 Recombinant Protein (Mouse)
RP139670	ABM	100 ug	Ask for price

G Protein-Coupled Receptor 6 (GPR6) Antibody
20-abx007385	Abbexa	EUR 411.00 EUR 592.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

G Protein-Coupled Receptor 6 (GPR6) Antibody
20-abx214714	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

G Protein-Coupled Receptor 6 (GPR6) Antibody
20-abx214733	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Gpr6 ORF Vector (Rat) (pORF)
ORF067816	ABM	1.0 ug DNA	EUR 506

GPR6 ORF Vector (Human) (pORF)
ORF013196	ABM	1.0 ug DNA	EUR 354

GPR6 Rabbit Polyclonal Antibody