RAMP1 Rabbit Polyclonal Antibody

RAMP1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    RAMP1 Polyclonal Antibody

    ABP60084-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human RAMP1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of RAMP1 from Human, Mouse, Rat. This RAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAMP1 protein

    RAMP1 Polyclonal Antibody

    ES11932-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against RAMP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    RAMP1 Polyclonal Antibody

    ES11932-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against RAMP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    RAMP1 Rabbit pAb

    A6447-100ul 100 ul
    EUR 308

    RAMP1 Rabbit pAb

    A6447-200ul 200 ul
    EUR 459

    RAMP1 Rabbit pAb

    A6447-20ul 20 ul
    EUR 183

    RAMP1 Rabbit pAb

    A6447-50ul 50 ul
    EUR 223

    Polyclonal RAMP1 (extracellular) Antibody

    APR13064G 0.05ml
    EUR 659
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAMP1 (extracellular) . This antibody is tested and proven to work in the following applications:

    RAMP1 antibody

    22090-100ul 100ul
    EUR 390

    RAMP1 antibody

    70R-13202 100 ul
    EUR 457
    Description: Affinity purified Rabbit polyclonal RAMP1 antibody

    RAMP1 antibody

    70R-19757 50 ul
    EUR 435
    Description: Rabbit polyclonal RAMP1 antibody

    RAMP1 Antibody

    35885-100ul 100ul
    EUR 252

    RAMP1 antibody

    38925-100ul 100ul
    EUR 252

    RAMP1 Antibody

    1-CSB-PA995687
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against RAMP1. Recognizes RAMP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:10-1:50

    RAMP1 Antibody

    DF8597 200ul
    EUR 304
    Description: RAMP1 Antibody detects endogenous levels of total RAMP1.

    RAMP1 Antibody

    1-CSB-PA019304GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against RAMP1. Recognizes RAMP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    RAMP1 Antibody

    ABD8597 100 ug
    EUR 438

    RAMP1 Conjugated Antibody

    C35885 100ul
    EUR 397

    RAMP1 Conjugated Antibody

    C38925 100ul
    EUR 397

    anti- RAMP1 antibody

    FNab07097 100µg
    EUR 585
    • Recommended dilution: WB: 1:500 - 1:2000
    • IHC: 1:50 - 1:200
    • Immunogen: receptor(G protein-coupled) activity modifying protein 1
    • Uniprot ID: O60894
    • Gene ID: 10267
    • Research Area: Signal Transduction
    Description: Antibody raised against RAMP1

    Anti-RAMP1 antibody

    PAab07097 100 ug
    EUR 412

    Anti-RAMP1 antibody

    STJ28530 100 µl
    EUR 277
    Description: The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP1) protein, CRLR functions as a CGRP receptor. The RAMP1 protein is involved in the terminal glycosylation, maturation, and presentation of the CGRP receptor to the cell surface. Alternative splicing results in multiple transcript variants encoding different isoforms.

    Anti-RAMP1 antibody

    STJ193090 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to RAMP1

    Ramp1/ Rat Ramp1 ELISA Kit

    ELI-44293r 96 Tests
    EUR 886

    RAMP1 siRNA

    20-abx904458
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RAMP1 siRNA

    20-abx930840
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RAMP1 siRNA

    20-abx930841
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    pOTB7-RAMP1

    PVT18751 2 ug
    EUR 231

    anti-RAMP1

    YF-PA25528 50 ul
    EUR 334
    Description: Mouse polyclonal to RAMP1

    Polyclonal Goat Anti-Ramp1 (C-Term., mouse) Antibody

    AMM05953G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Ramp1 (C-Term., mouse) . This antibody is tested and proven to work in the following applications:

    RAMP1 Blocking Peptide

    DF8597-BP 1mg
    EUR 195

    RAMP1 Blocking Peptide

    20-abx161402
    • EUR 606.00
    • EUR 1428.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.

    RAMP1 cloning plasmid

    CSB-CL019304HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 447
    • Sequence: atggcccgggccctgtgccgcctcccgcggcgcggcctctggctgctcctggcccatcacctcttcatgaccactgcctgccaggaggctaactacggtgccctcctccgggagctctgcctcacccagttccaggtagacatggaggccgtcggggagacgctgtggtgtgactg
    • Show more
    Description: A cloning plasmid for the RAMP1 gene.

    Anti-RAMP1 (1F1)

    YF-MA17226 100 ug
    EUR 363
    Description: Mouse monoclonal to RAMP1

    Anti-RAMP1 (3B9)

    YF-MA20491 100 ug
    EUR 363
    Description: Mouse monoclonal to RAMP1

    RAMP1 protein (His tag)

    80R-3651 50 ug
    EUR 435
    Description: Purified recombinant RAMP1 protein (His tag)

    RAMP1 ELISA KIT|Human

    EF007381 96 Tests
    EUR 689

    Mouse RAMP1 shRNA Plasmid

    20-abx974187
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat RAMP1 shRNA Plasmid

    20-abx985944
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human RAMP1 shRNA Plasmid

    20-abx956950
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    RAMP1 Recombinant Protein (Human)

    RP025717 100 ug Ask for price

    RAMP1 Recombinant Protein (Mouse)

    RP166682 100 ug Ask for price

    RAMP1 Recombinant Protein (Mouse)

    RP166685 100 ug Ask for price

    RAMP1 Recombinant Protein (Mouse)

    RP166688 100 ug Ask for price

    RAMP1 Recombinant Protein (Rat)

    RP223553 100 ug Ask for price

    Anti-Ramp1 (C-Term., mouse) antibody

    STJ71612 100 µg
    EUR 359

    Receptor Activity Modifying Protein 1 (RAMP1) Antibody

    20-abx004940
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Receptor Activity Modifying Protein 1 (RAMP1) Antibody

    20-abx211682
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Receptor Activity Modifying Protein 1 (RAMP1) Antibody

    20-abx115081
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Receptor Activity Modifying Protein 1 (RAMP1) Antibody

    20-abx121692
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Monoclonal RAMP1 Antibody (monoclonal) (M01), Clone: 1F1

    APR13065G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human RAMP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1F1. This antibody is applicable in E

    Receptor Activity Modifying Protein 1 (RAMP1) Antibody

    abx237097-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.

    Receptor Activity Modifying Protein 1 (Ramp1) Antibody

    abx431959-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    Ramp1 ORF Vector (Rat) (pORF)

    ORF074519 1.0 ug DNA
    EUR 506

    RAMP1 ORF Vector (Human) (pORF)

    ORF008573 1.0 ug DNA
    EUR 95

    Ramp1 ORF Vector (Mouse) (pORF)

    ORF055562 1.0 ug DNA
    EUR 506

    Ramp1 ORF Vector (Mouse) (pORF)

    ORF055563 1.0 ug DNA
    EUR 506

    Ramp1 ORF Vector (Mouse) (pORF)

    ORF055564 1.0 ug DNA
    EUR 506

    RAMP1 ELISA Kit (Human) (OKCA01483)

    OKCA01483 96 Wells
    EUR 846
    Description: Description of target: Transports the calcitonin gene-related peptide type 1 receptor (CALCRL) to the plasma membrane. Acts as a receptor for calcitonin-gene-related peptide (CGRP) together with CALCRL.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7 pg/mL

    Rabbit Anti-Human Receptor Activity Modifying Protein 1 (RAMP1) antiserum #1

    RAMP11-S 100 ul
    EUR 457

    Ramp1 sgRNA CRISPR Lentivector set (Mouse)

    K5029701 3 x 1.0 ug
    EUR 339

    Ramp1 sgRNA CRISPR Lentivector set (Rat)

    K6866501 3 x 1.0 ug
    EUR 339

    RAMP1 sgRNA CRISPR Lentivector set (Human)

    K1783101 3 x 1.0 ug
    EUR 339

    Ramp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K5029702 1.0 ug DNA
    EUR 154

    Ramp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K5029703 1.0 ug DNA
    EUR 154

    Ramp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K5029704 1.0 ug DNA
    EUR 154

    Ramp1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6866502 1.0 ug DNA
    EUR 154

    Ramp1 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6866503 1.0 ug DNA
    EUR 154

    Ramp1 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6866504 1.0 ug DNA
    EUR 154

    RAMP1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1783102 1.0 ug DNA
    EUR 154

    RAMP1 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1783103 1.0 ug DNA
    EUR 154

    RAMP1 sgRNA CRISPR Lentivector (Human) (Target 3)

    K1783104 1.0 ug DNA
    EUR 154

    RAMP1 Protein Vector (Rat) (pPB-C-His)

    PV298074 500 ng
    EUR 603

    RAMP1 Protein Vector (Rat) (pPB-N-His)

    PV298075 500 ng
    EUR 603

    RAMP1 Protein Vector (Rat) (pPM-C-HA)

    PV298076 500 ng
    EUR 603

    RAMP1 Protein Vector (Rat) (pPM-C-His)

    PV298077 500 ng
    EUR 603

    RAMP1 Protein Vector (Human) (pPB-C-His)

    PV034289 500 ng
    EUR 329

    RAMP1 Protein Vector (Human) (pPB-N-His)

    PV034290 500 ng
    EUR 329

    RAMP1 Protein Vector (Human) (pPM-C-HA)

    PV034291 500 ng
    EUR 329

    RAMP1 Protein Vector (Human) (pPM-C-His)

    PV034292 500 ng
    EUR 329

    RAMP1 Protein Vector (Mouse) (pPB-C-His)

    PV222246 500 ng
    EUR 603

    RAMP1 Protein Vector (Mouse) (pPB-N-His)

    PV222247 500 ng
    EUR 603

    RAMP1 Protein Vector (Mouse) (pPM-C-HA)

    PV222248 500 ng
    EUR 603

    RAMP1 Protein Vector (Mouse) (pPM-C-His)

    PV222249 500 ng
    EUR 603

    RAMP1 Protein Vector (Mouse) (pPB-C-His)

    PV222250 500 ng
    EUR 603

    RAMP1 Protein Vector (Mouse) (pPB-N-His)

    PV222251 500 ng
    EUR 603

    RAMP1 Protein Vector (Mouse) (pPM-C-HA)

    PV222252 500 ng
    EUR 603

    RAMP1 Protein Vector (Mouse) (pPM-C-His)

    PV222253 500 ng
    EUR 603

    RAMP1 Protein Vector (Mouse) (pPB-C-His)

    PV222254 500 ng
    EUR 603

    RAMP1 Protein Vector (Mouse) (pPB-N-His)

    PV222255 500 ng
    EUR 603

    RAMP1 Protein Vector (Mouse) (pPM-C-HA)

    PV222256 500 ng
    EUR 603

    RAMP1 Protein Vector (Mouse) (pPM-C-His)

    PV222257 500 ng
    EUR 603

    Recombinant Human RAMP1 Protein, His, E.coli-10ug

    QP13259-10ug 10ug
    EUR 201

    Recombinant Human RAMP1 Protein, His, E.coli-1mg

    QP13259-1mg 1mg
    EUR 5251

    Recombinant Human RAMP1 Protein, His, E.coli-2ug

    QP13259-2ug 2ug
    EUR 155

    Ramp1 3'UTR Luciferase Stable Cell Line

    TU117509 1.0 ml Ask for price

    Ramp1 3'UTR GFP Stable Cell Line

    TU167509 1.0 ml Ask for price

    Ramp1 3'UTR Luciferase Stable Cell Line

    TU217282 1.0 ml Ask for price

    RAMP1 Rabbit Polyclonal Antibody