ABCA1 Rabbit Polyclonal Antibody

ABCA1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

ABCA1 Polyclonal Antibody
ABP57645-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ABCA1 protein Applications tips:
Description: A polyclonal antibody for detection of ABCA1 from Human, Mouse. This ABCA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCA1 protein

ABCA1 Polyclonal Antibody
ES11793-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ABCA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABCA1 Polyclonal Antibody
ES11793-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ABCA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABCA1 Rabbit pAb
A16337-100ul	Abclonal	100 ul	EUR 308

ABCA1 Rabbit pAb
A16337-200ul	Abclonal	200 ul	EUR 459

ABCA1 Rabbit pAb
A16337-20ul	Abclonal	20 ul	EUR 183

ABCA1 Rabbit pAb
A16337-50ul	Abclonal	50 ul	EUR 223

ABCA1 Rabbit pAb
A7228-100ul	Abclonal	100 ul	EUR 308

ABCA1 Rabbit pAb
A7228-200ul	Abclonal	200 ul	EUR 459

ABCA1 Rabbit pAb
A7228-20ul	Abclonal	20 ul	EUR 183

ABCA1 Rabbit pAb
A7228-50ul	Abclonal	50 ul	EUR 223

Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
DLR-ABCA1-Hu-48T	DL Develop	48T	EUR 498
Should the Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter A1 (ABCA1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
DLR-ABCA1-Hu-96T	DL Develop	96T	EUR 647
Should the Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter A1 (ABCA1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
DLR-ABCA1-Mu-48T	DL Develop	48T	EUR 508
Should the Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATP Binding Cassette Transporter A1 (ABCA1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
DLR-ABCA1-Mu-96T	DL Develop	96T	EUR 661
Should the Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATP Binding Cassette Transporter A1 (ABCA1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RD-ABCA1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RD-ABCA1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RD-ABCA1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RD-ABCA1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RDR-ABCA1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RDR-ABCA1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RDR-ABCA1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534

Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RDR-ABCA1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742

Rabbit ABCA1 ELISA Kit
ERTA0638	Abclonal	96Tests	EUR 521

ABCA1 Antibody
21676-100ul	SAB	100ul	EUR 252

ABCA1 Antibody
21676-50ul	SAB	50ul	EUR 187

ABCA1 Antibody
43463-100ul	SAB	100ul	EUR 252

ABCA1 Antibody
DF8233	Affbiotech	200ul	EUR 304
Description: ABCA1 Antibody detects endogenous levels of total ABCA1.

Abca1 antibody
70R-8568	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Abca1 antibody

ABCA1 antibody
70R-51245	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal ABCA1 antibody

ABCA1 Antibody
ABD8233	Lifescience Market	100 ug	EUR 438

ABCA1
MO13101	Neuromics	100 ul	EUR 409

ABCA1 Conjugated Antibody
C21676	SAB	100ul	EUR 397

Anti-ABCA1 Antibody
PA1843	BosterBio	100ug/vial	EUR 294

Anti-ABCA1 Antibody
PB9467	BosterBio	100ug/vial	EUR 294

Anti-ABCA1 antibody
STJ118777	St John's Laboratory	100 µl	EUR 277

Anti-ABCA1 antibody
STJ29308	St John's Laboratory	100 µl	EUR 277
Description: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. With cholesterol as its substrate, this protein functions as a cholesteral efflux pump in the cellular lipid removal pathway. Mutations in this gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency.

Anti-ABCA1 antibody
STJ192951	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ABCA1

ABCA1 siRNA
20-abx906284	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ABCA1 siRNA
20-abx906285	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Abca1 Blocking Peptide
33R-6863	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Abca1 antibody, catalog no. 70R-8568

ABCA1 Blocking Peptide
DF8233-BP	Affbiotech	1mg	EUR 195

ABCA1 Blocking Peptide
20-abx064120	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

ABCA1 cloning plasmid
CSB-CL001033HU-10ug	Cusabio	10ug	EUR 339
Formulation: 10 μg plasmid + 200μl Glycerol Length: 819 Sequence: ATGGCTTGTTGGCCTCAGCTGAGGTTGCTGCTGTGGAAGAACCTCACTTTCAGAAGAAGACAAACATGTCAGCTGCTGCTGGAAGTGGCCTGGCCTCTATTTATCTTCCTGATCCTGATCTCTGTTCGGCTGAGCTACCCACCCTATGAACAACATGAATGCCATTTTCCAAATAA Show more
Description: A cloning plasmid for the ABCA1 gene.

Anti-ABCA1 (1H4)
YF-MA11791	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to ABCA1

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human)
4-PAB242Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Asn1385~Phe1663) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1)

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse)
4-PAB242Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Leu1404~Phe1663) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1)

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), APC
4-PAB242Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Asn1385~Phe1663) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), Biotinylated
4-PAB242Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Asn1385~Phe1663) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), Cy3
4-PAB242Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Asn1385~Phe1663) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), FITC
4-PAB242Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Asn1385~Phe1663) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with FITC.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), HRP
4-PAB242Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Asn1385~Phe1663) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with HRP.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), PE
4-PAB242Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Asn1385~Phe1663) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with PE.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), APC
4-PAB242Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Leu1404~Phe1663) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), Biotinylated
4-PAB242Mu01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Leu1404~Phe1663) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), Cy3
4-PAB242Mu01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Leu1404~Phe1663) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), FITC
4-PAB242Mu01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Leu1404~Phe1663) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with FITC.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), HRP
4-PAB242Mu01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Leu1404~Phe1663) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with HRP.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), PE
4-PAB242Mu01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Leu1404~Phe1663) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with PE.

Rat Anti Mouse Abca1 Monoclonal Antibody
CABT-50918RM	Creative Diagnostics	0.25 mg	EUR 580

Human ABCA1 ELISA Kit
EHA0638	Abclonal	96Tests	EUR 521

Human ABCA1 ELISA Kit
ELA-E1242h	Lifescience Market	96 Tests	EUR 824

Goat ABCA1 ELISA Kit
EGTA0638	Abclonal	96Tests	EUR 521

Canine ABCA1 ELISA Kit
ECA0638	Abclonal	96Tests	EUR 521

Chicken ABCA1 ELISA Kit
ECKA0638	Abclonal	96Tests	EUR 521

Anserini ABCA1 ELISA Kit
EAA0638	Abclonal	96Tests	EUR 521

Bovine ABCA1 ELISA Kit
EBA0638	Abclonal	96Tests	EUR 521

Human ABCA1 ELISA KIT
ELI-04120h	Lifescience Market	96 Tests	EUR 824

Mouse Abca1 ELISA KIT
ELI-04121m	Lifescience Market	96 Tests	EUR 865

ABCA1 ELISA KIT|Human
EF004761	Lifescience Market	96 Tests	EUR 689

Human ABCA1 shRNA Plasmid
20-abx950011	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ABCA1 shRNA Plasmid
20-abx968978	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ABCA1 ELISA Kit
EMA0638	Abclonal	96Tests	EUR 521

Rat ABCA1 ELISA Kit
ERA0638	Abclonal	96Tests	EUR 521

Sheep ABCA1 ELISA Kit
ESA0638	Abclonal	96Tests	EUR 521

Monkey ABCA1 ELISA Kit
EMKA0638	Abclonal	96Tests	EUR 521

Porcine ABCA1 ELISA Kit
EPA0638	Abclonal	96Tests	EUR 521

Rabbit ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
abx363663-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), APC-Cy7
4-PAB242Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Asn1385~Phe1663) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB242Mu01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA1 (Leu1404~Phe1663) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody
20-abx007896	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody
20-abx005455	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody
20-abx175490	Abbexa	EUR 1177.00 EUR 578.00	1 mg 200 ug
Please enquire.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody
20-abx103801	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody
20-abx128016	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody
abx038220-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody
20-abx171344	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Rat Anti Mouse Abca1 Monoclonal Antibody,RPE
CABT-50919RM	Creative Diagnostics	100 TEST	EUR 533

Rat Anti Mouse Abca1 Monoclonal Antibody,FITC
CABT-50920RM	Creative Diagnostics	0.1 mg	EUR 429

Guinea Pig ABCA1 ELISA Kit
EGA0638	Abclonal	96Tests	EUR 521

Abca1 ORF Vector (Rat) (pORF)
ORF062836	ABM	1.0 ug DNA	EUR 2396

ABCA1 ORF Vector (Human) (pORF)
ORF012121	ABM	1.0 ug DNA	EUR 354

Abca1 ORF Vector (Mouse) (pORF)
ORF037750	ABM	1.0 ug DNA	EUR 95

pGreenFire1-LXRE in ABCA1(plasmid)
TR106PA-P	SBI	10 ug	EUR 786
Category: Lentiviral Technology

pGreenFire1-LXRE in ABCA1(virus)
TR106VA-P	SBI	>2 x 10^6 IFUs	EUR 786
Category: Lentiviral Technology

ABCA1 ELISA Kit (Human) (OKCD07241)
OKCD07241	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. With cholesterol as its substrate, this protein functions as a cholesteral efflux pump in the cellular lipid removal pathway. Mutations in this gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

ABCA1 ELISA Kit (Mouse) (OKCD07242)
OKCD07242	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.060ng/mL

ABCA1 Rabbit Polyclonal Antibody