ABCA1 Rabbit Polyclonal Antibody

ABCA1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    ABCA1 Polyclonal Antibody
    ABP57645-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human ABCA1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ABCA1 from Human, Mouse. This ABCA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCA1 protein
    ABCA1 Polyclonal Antibody
    ES11793-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ABCA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    ABCA1 Polyclonal Antibody
    ES11793-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ABCA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    ABCA1 Rabbit pAb
    A16337-100ul 100 ul
    EUR 308
    ABCA1 Rabbit pAb
    A16337-200ul 200 ul
    EUR 459
    ABCA1 Rabbit pAb
    A16337-20ul 20 ul
    EUR 183
    ABCA1 Rabbit pAb
    A16337-50ul 50 ul
    EUR 223
    ABCA1 Rabbit pAb
    A7228-100ul 100 ul
    EUR 308
    ABCA1 Rabbit pAb
    A7228-200ul 200 ul
    EUR 459
    ABCA1 Rabbit pAb
    A7228-20ul 20 ul
    EUR 183
    ABCA1 Rabbit pAb
    A7228-50ul 50 ul
    EUR 223
    Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
    DLR-ABCA1-Hu-48T 48T
    EUR 498
    • Should the Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter A1 (ABCA1) in samples from tissue homogenates, cell lysates or other biological fluids.
    Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
    DLR-ABCA1-Hu-96T 96T
    EUR 647
    • Should the Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter A1 (ABCA1) in samples from tissue homogenates, cell lysates or other biological fluids.
    Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
    DLR-ABCA1-Mu-48T 48T
    EUR 508
    • Should the Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATP Binding Cassette Transporter A1 (ABCA1) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
    DLR-ABCA1-Mu-96T 96T
    EUR 661
    • Should the Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATP Binding Cassette Transporter A1 (ABCA1) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
    RD-ABCA1-Hu-48Tests 48 Tests
    EUR 500
    Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
    RD-ABCA1-Hu-96Tests 96 Tests
    EUR 692
    Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
    RD-ABCA1-Mu-48Tests 48 Tests
    EUR 511
    Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
    RD-ABCA1-Mu-96Tests 96 Tests
    EUR 709
    Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
    RDR-ABCA1-Hu-48Tests 48 Tests
    EUR 522
    Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
    RDR-ABCA1-Hu-96Tests 96 Tests
    EUR 724
    Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
    RDR-ABCA1-Mu-48Tests 48 Tests
    EUR 534
    Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
    RDR-ABCA1-Mu-96Tests 96 Tests
    EUR 742
    Rabbit ABCA1 ELISA Kit
    ERTA0638 96Tests
    EUR 521
    ABCA1 Antibody
    21676-100ul 100ul
    EUR 252
    ABCA1 Antibody
    21676-50ul 50ul
    EUR 187
    ABCA1 Antibody
    43463-100ul 100ul
    EUR 252
    ABCA1 Antibody
    DF8233 200ul
    EUR 304
    Description: ABCA1 Antibody detects endogenous levels of total ABCA1.
    Abca1 antibody
    70R-8568 50 ug
    EUR 467
    Description: Affinity purified rabbit polyclonal Abca1 antibody
    ABCA1 antibody
    70R-51245 100 ul
    EUR 244
    Description: Purified Polyclonal ABCA1 antibody
    ABCA1 Antibody
    ABD8233 100 ug
    EUR 438
    ABCA1
    MO13101 100 ul
    EUR 409
    ABCA1 Conjugated Antibody
    C21676 100ul
    EUR 397
    Anti-ABCA1 Antibody
    PA1843 100ug/vial
    EUR 294
    Anti-ABCA1 Antibody
    PB9467 100ug/vial
    EUR 294
    Anti-ABCA1 antibody
    STJ118777 100 µl
    EUR 277
    Anti-ABCA1 antibody
    STJ29308 100 µl
    EUR 277
    Description: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. With cholesterol as its substrate, this protein functions as a cholesteral efflux pump in the cellular lipid removal pathway. Mutations in this gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency.
    Anti-ABCA1 antibody
    STJ192951 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to ABCA1
    ABCA1 siRNA
    20-abx906284
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    ABCA1 siRNA
    20-abx906285
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Abca1 Blocking Peptide
    33R-6863 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Abca1 antibody, catalog no. 70R-8568
    ABCA1 Blocking Peptide
    DF8233-BP 1mg
    EUR 195
    ABCA1 Blocking Peptide
    20-abx064120
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.
    ABCA1 cloning plasmid
    CSB-CL001033HU-10ug 10ug
    EUR 339
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 819
    • Sequence: ATGGCTTGTTGGCCTCAGCTGAGGTTGCTGCTGTGGAAGAACCTCACTTTCAGAAGAAGACAAACATGTCAGCTGCTGCTGGAAGTGGCCTGGCCTCTATTTATCTTCCTGATCCTGATCTCTGTTCGGCTGAGCTACCCACCCTATGAACAACATGAATGCCATTTTCCAAATAA
    • Show more
    Description: A cloning plasmid for the ABCA1 gene.
    Anti-ABCA1 (1H4)
    YF-MA11791 200 ul
    EUR 363
    Description: Mouse monoclonal to ABCA1
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human)
    4-PAB242Hu01
    • EUR 239.00
    • EUR 2391.00
    • EUR 598.00
    • EUR 299.00
    • EUR 211.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1)
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse)
    4-PAB242Mu01
    • EUR 243.00
    • EUR 2457.00
    • EUR 613.00
    • EUR 305.00
    • EUR 212.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1)
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), APC
    4-PAB242Hu01-APC
    • EUR 333.00
    • EUR 3113.00
    • EUR 872.00
    • EUR 423.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC.
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), Biotinylated
    4-PAB242Hu01-Biotin
    • EUR 303.00
    • EUR 2341.00
    • EUR 697.00
    • EUR 369.00
    • EUR 216.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Biotin.
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), Cy3
    4-PAB242Hu01-Cy3
    • EUR 403.00
    • EUR 4109.00
    • EUR 1121.00
    • EUR 523.00
    • EUR 245.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Cy3.
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), FITC
    4-PAB242Hu01-FITC
    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with FITC.
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), HRP
    4-PAB242Hu01-HRP
    • EUR 305.00
    • EUR 2714.00
    • EUR 772.00
    • EUR 383.00
    • EUR 203.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with HRP.
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), PE
    4-PAB242Hu01-PE
    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with PE.
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), APC
    4-PAB242Mu01-APC
    • EUR 340.00
    • EUR 3203.00
    • EUR 894.00
    • EUR 432.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC.
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), Biotinylated
    4-PAB242Mu01-Biotin
    • EUR 307.00
    • EUR 2407.00
    • EUR 714.00
    • EUR 375.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Biotin.
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), Cy3
    4-PAB242Mu01-Cy3
    • EUR 411.00
    • EUR 4229.00
    • EUR 1151.00
    • EUR 535.00
    • EUR 248.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Cy3.
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), FITC
    4-PAB242Mu01-FITC
    • EUR 292.00
    • EUR 2582.00
    • EUR 735.00
    • EUR 366.00
    • EUR 194.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with FITC.
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), HRP
    4-PAB242Mu01-HRP
    • EUR 311.00
    • EUR 2792.00
    • EUR 791.00
    • EUR 391.00
    • EUR 205.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with HRP.
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), PE
    4-PAB242Mu01-PE
    • EUR 292.00
    • EUR 2582.00
    • EUR 735.00
    • EUR 366.00
    • EUR 194.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with PE.
    Rat Anti Mouse Abca1 Monoclonal Antibody
    CABT-50918RM 0.25 mg
    EUR 580
    Human ABCA1 ELISA Kit
    EHA0638 96Tests
    EUR 521
    Human ABCA1 ELISA Kit
    ELA-E1242h 96 Tests
    EUR 824
    Goat ABCA1 ELISA Kit
    EGTA0638 96Tests
    EUR 521
    Canine ABCA1 ELISA Kit
    ECA0638 96Tests
    EUR 521
    Chicken ABCA1 ELISA Kit
    ECKA0638 96Tests
    EUR 521
    Anserini ABCA1 ELISA Kit
    EAA0638 96Tests
    EUR 521
    Bovine ABCA1 ELISA Kit
    EBA0638 96Tests
    EUR 521
    Human ABCA1 ELISA KIT
    ELI-04120h 96 Tests
    EUR 824
    Mouse Abca1 ELISA KIT
    ELI-04121m 96 Tests
    EUR 865
    ABCA1 ELISA KIT|Human
    EF004761 96 Tests
    EUR 689
    Human ABCA1 shRNA Plasmid
    20-abx950011
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse ABCA1 shRNA Plasmid
    20-abx968978
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse ABCA1 ELISA Kit
    EMA0638 96Tests
    EUR 521
    Rat ABCA1 ELISA Kit
    ERA0638 96Tests
    EUR 521
    Sheep ABCA1 ELISA Kit
    ESA0638 96Tests
    EUR 521
    Monkey ABCA1 ELISA Kit
    EMKA0638 96Tests
    EUR 521
    Porcine ABCA1 ELISA Kit
    EPA0638 96Tests
    EUR 521
    Rabbit ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
    abx363663-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), APC-Cy7
    4-PAB242Hu01-APC-Cy7
    • EUR 547.00
    • EUR 6106.00
    • EUR 1624.00
    • EUR 727.00
    • EUR 310.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC-Cy7.
    ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), APC-Cy7
    4-PAB242Mu01-APC-Cy7
    • EUR 560.00
    • EUR 6286.00
    • EUR 1669.00
    • EUR 745.00
    • EUR 315.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC-Cy7.
    ATP Binding Cassette Transporter A1 (ABCA1) Antibody
    20-abx007896
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.
    ATP Binding Cassette Transporter A1 (ABCA1) Antibody
    20-abx005455
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    ATP Binding Cassette Transporter A1 (ABCA1) Antibody
    20-abx175490
    • EUR 1177.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.
    ATP Binding Cassette Transporter A1 (ABCA1) Antibody
    20-abx103801
    • EUR 425.00
    • EUR 133.00
    • EUR 1177.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    ATP Binding Cassette Transporter A1 (ABCA1) Antibody
    20-abx128016
    • EUR 411.00
    • EUR 133.00
    • EUR 1149.00
    • EUR 565.00
    • EUR 314.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    ATP Binding Cassette Transporter A1 (ABCA1) Antibody
    abx038220-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    ATP Binding Cassette Transporter A1 (ABCA1) Antibody
    20-abx171344
    • EUR 815.00
    • EUR 425.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Rat Anti Mouse Abca1 Monoclonal Antibody,RPE
    CABT-50919RM 100 TEST
    EUR 533
    Rat Anti Mouse Abca1 Monoclonal Antibody,FITC
    CABT-50920RM 0.1 mg
    EUR 429
    Guinea Pig ABCA1 ELISA Kit
    EGA0638 96Tests
    EUR 521
    Abca1 ORF Vector (Rat) (pORF)
    ORF062836 1.0 ug DNA
    EUR 2396
    ABCA1 ORF Vector (Human) (pORF)
    ORF012121 1.0 ug DNA
    EUR 354
    Abca1 ORF Vector (Mouse) (pORF)
    ORF037750 1.0 ug DNA
    EUR 95
    pGreenFire1-LXRE in ABCA1(plasmid)
    TR106PA-P 10 ug
    EUR 786
    • Category: Lentiviral Technology
    pGreenFire1-LXRE in ABCA1(virus)
    TR106VA-P >2 x 10^6 IFUs
    EUR 786
    • Category: Lentiviral Technology
    ABCA1 ELISA Kit (Human) (OKCD07241)
    OKCD07241 96 Wells
    EUR 936
    Description: Description of target: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. With cholesterol as its substrate, this protein functions as a cholesteral efflux pump in the cellular lipid removal pathway. Mutations in this gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL
    ABCA1 ELISA Kit (Mouse) (OKCD07242)
    OKCD07242 96 Wells
    EUR 818
    Description: Description of target: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.060ng/mL

    ABCA1 Rabbit Polyclonal Antibody