GPR78 Rabbit Polyclonal Antibody

GPR78 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    GPR78 Polyclonal Antibody

    ABP58697-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370
    • Applications tips:
    Description: A polyclonal antibody for detection of GPR78 from Human. This GPR78 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370

    GPR78 Polyclonal Antibody

    ABP58697-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370
    • Applications tips:
    Description: A polyclonal antibody for detection of GPR78 from Human. This GPR78 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370

    GPR78 Polyclonal Antibody

    ABP58697-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370
    • Applications tips:
    Description: A polyclonal antibody for detection of GPR78 from Human. This GPR78 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370

    GPR78 Rabbit pAb

    A12364-100ul 100 ul
    EUR 308

    GPR78 Rabbit pAb

    A12364-200ul 200 ul
    EUR 459

    GPR78 Rabbit pAb

    A12364-20ul 20 ul
    EUR 183

    GPR78 Rabbit pAb

    A12364-50ul 50 ul
    EUR 223

    Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit

    DLR-GPR78-Hu-48T 48T
    EUR 517
    • Should the Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Receptor 78 (GPR78) in samples from tissue homogenates or other biological fluids.

    Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit

    DLR-GPR78-Hu-96T 96T
    EUR 673
    • Should the Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Receptor 78 (GPR78) in samples from tissue homogenates or other biological fluids.

    Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit

    RD-GPR78-Hu-48Tests 48 Tests
    EUR 521

    Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit

    RD-GPR78-Hu-96Tests 96 Tests
    EUR 723

    Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit

    RDR-GPR78-Hu-48Tests 48 Tests
    EUR 544

    Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit

    RDR-GPR78-Hu-96Tests 96 Tests
    EUR 756

    GPR78 Antibody

    ABD2763 100 ug
    EUR 438

    GPR78 Antibody

    37609-100ul 100ul
    EUR 252

    GPR78 Antibody

    DF2763 200ul
    EUR 304
    Description: GPR78 antibody detects endogenous levels of total GPR78.

    GPR78 Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against GPR78. Recognizes GPR78 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

    Polyclonal GPR78 Antibody (C-Terminus)

    APR16605G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 (C-Terminus). This antibody is tested and proven to work in the following applications:

    Polyclonal GPR78 Antibody (Cytoplasmic Domain)

    APR16606G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

    GPR78 Conjugated Antibody

    C37609 100ul
    EUR 397

    Anti-GPR78 antibody

    STJ114242 100 µl
    EUR 277
    Description: The protein encoded by this gene belongs to the G protein-coupled receptor family, which contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. This is an orphan receptor, which displays significant level of constitutive activity. Association analysis shows preliminary evidence for the involvement of this gene in susceptibility to bipolar affective disorder and schizophrenia. Alternatively spliced transcript variants have been found for this gene.

    Anti-GPR78 antibody

    STJ192638 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to GPR78

    Polyclonal GPR78 Antibody - C-terminal region

    APR16607G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 - C-terminal region. This antibody is tested and proven to work in the following applications:

    GPR78 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    GPR78 Blocking Peptide

    DF2763-BP 1mg
    EUR 195

    GPR78 cloning plasmid

    CSB-CL850406HU-10ug 10ug
    EUR 415
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1092
    • Sequence: atgggccccggcgaggcgctgctggcgggtctcctggtgatggtactggccgtggcgctgctatccaacgcactggtgctgctttgttgcgcctacagcgctgagctccgcactcgagcctcaggcgtcctcctggtgaatctgtctctgggccacctgctgctggcggcgctgg
    • Show more
    Description: A cloning plasmid for the GPR78 gene.

    Human GPR78 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    GPR78 Recombinant Protein (Human)

    RP013894 100 ug Ask for price

    G Protein Coupled Receptor 78 (GPR78) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    G Protein Coupled Receptor 78 (GPR78) Antibody

    abx029634-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    G Protein Coupled Receptor 78 (GPR78) Antibody

    abx029634-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    G Protein Coupled Receptor 78 (GPR78) Antibody

    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    G Protein Coupled Receptor 78 (GPR78) Antibody

    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    G Protein Coupled Receptor 78 (GPR78) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    GPR78 ORF Vector (Human) (pORF)

    ORF004632 1.0 ug DNA
    EUR 95

    GPR78 ELISA Kit (Human) (OKCD08975)

    OKCD08975 96 Wells
    EUR 975
    Description: Description of target: The protein encoded by this gene belongs to the G protein-coupled receptor family, which contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. This is an orphan receptor, which displays significant level of constitutive activity. Association analysis shows preliminary evidence for the involvement of this gene in susceptibility to bipolar affective disorder and schizophrenia. Alternatively spliced transcript variants have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

    GPR78 ELISA Kit (Human) (OKDD00294)

    OKDD00294 96 Wells
    EUR 975
    Description: Description of target: The protein encoded by this gene belongs to the G protein-coupled receptor family, which contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. This is an orphan receptor, which displays significant level of constitutive activity. Association analysis shows preliminary evidence for the involvement of this gene in susceptibility to bipolar affective disorder and schizophrenia. Alternatively spliced transcript variants have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.059 ng/mL

    GPR78 sgRNA CRISPR Lentivector set (Human)

    K0893001 3 x 1.0 ug
    EUR 339

    GPR78 sgRNA CRISPR Lentivector (Human) (Target 1)

    K0893002 1.0 ug DNA
    EUR 154

    GPR78 sgRNA CRISPR Lentivector (Human) (Target 2)

    K0893003 1.0 ug DNA
    EUR 154

    GPR78 sgRNA CRISPR Lentivector (Human) (Target 3)

    K0893004 1.0 ug DNA
    EUR 154

    GPR78 Protein Vector (Human) (pPB-C-His)

    PV018525 500 ng
    EUR 329

    GPR78 Protein Vector (Human) (pPB-N-His)

    PV018526 500 ng
    EUR 329

    GPR78 Protein Vector (Human) (pPM-C-HA)

    PV018527 500 ng
    EUR 329

    GPR78 Protein Vector (Human) (pPM-C-His)

    PV018528 500 ng
    EUR 329

    GPR78 3'UTR Luciferase Stable Cell Line

    TU009181 1.0 ml
    EUR 1521

    GPR78 3'UTR GFP Stable Cell Line

    TU059181 1.0 ml
    EUR 1521

    Human G Protein Coupled Receptor 78 (GPR78) Protein

    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Human G- protein coupled receptor 78, GPR78 ELISA KIT

    ELI-09605h 96 Tests
    EUR 824

    Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human G Protein Coupled Receptor 78 (GPR78) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit

    SEG738Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human G Protein Coupled Receptor 78 (GPR78) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human G Protein Coupled Receptor 78 (GPR78) in Tissue homogenates and other biological fluids.

    GPR78 Rabbit Polyclonal Antibody