GPR78 Rabbit Polyclonal Antibody

GPR78 Rabbit Polyclonal Antibody

Contact Us Below To Order :

GPR78 Polyclonal Antibody
ABP58697-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370 Applications tips:
Description: A polyclonal antibody for detection of GPR78 from Human. This GPR78 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370

GPR78 Polyclonal Antibody
ES11480-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GPR78 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPR78 Polyclonal Antibody
ES11480-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GPR78 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPR78 Rabbit pAb
A12364-100ul	Abclonal	100 ul	EUR 308

GPR78 Rabbit pAb
A12364-200ul	Abclonal	200 ul	EUR 459

GPR78 Rabbit pAb
A12364-20ul	Abclonal	20 ul	EUR 183

GPR78 Rabbit pAb
A12364-50ul	Abclonal	50 ul	EUR 223

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit
DLR-GPR78-Hu-48T	DL Develop	48T	EUR 517
Should the Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Receptor 78 (GPR78) in samples from tissue homogenates or other biological fluids.

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit
DLR-GPR78-Hu-96T	DL Develop	96T	EUR 673
Should the Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Receptor 78 (GPR78) in samples from tissue homogenates or other biological fluids.

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit
RDR-GPR78-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit
RDR-GPR78-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit
RD-GPR78-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit
RD-GPR78-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

GPR78 Antibody
37609-100ul	SAB	100ul	EUR 252

GPR78 Antibody
DF2763	Affbiotech	200ul	EUR 304
Description: GPR78 antibody detects endogenous levels of total GPR78.

GPR78 Antibody
1-CSB-PA419324	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GPR78. Recognizes GPR78 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

GPR78 Antibody
ABD2763	Lifescience Market	100 ug	EUR 438

Polyclonal GPR78 Antibody (C-Terminus)
APR16605G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GPR78 Antibody (Cytoplasmic Domain)
APR16606G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

GPR78 Conjugated Antibody
C37609	SAB	100ul	EUR 397

Anti-GPR78 antibody
STJ114242	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the G protein-coupled receptor family, which contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. This is an orphan receptor, which displays significant level of constitutive activity. Association analysis shows preliminary evidence for the involvement of this gene in susceptibility to bipolar affective disorder and schizophrenia. Alternatively spliced transcript variants have been found for this gene.

Anti-GPR78 antibody
STJ192638	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GPR78

Polyclonal GPR78 Antibody - C-terminal region
APR16607G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 - C-terminal region. This antibody is tested and proven to work in the following applications:

GPR78 siRNA
20-abx918555	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPR78 Blocking Peptide
DF2763-BP	Affbiotech	1mg	EUR 195

GPR78 cloning plasmid
CSB-CL850406HU-10ug	Cusabio	10ug	EUR 415
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1092 Sequence: atgggccccggcgaggcgctgctggcgggtctcctggtgatggtactggccgtggcgctgctatccaacgcactggtgctgctttgttgcgcctacagcgctgagctccgcactcgagcctcaggcgtcctcctggtgaatctgtctctgggccacctgctgctggcggcgctgg Show more
Description: A cloning plasmid for the GPR78 gene.

Human GPR78 shRNA Plasmid
20-abx959021	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GPR78 Recombinant Protein (Human)
RP013894	ABM	100 ug	Ask for price

GPR78 ORF Vector (Human) (pORF)
ORF004632	ABM	1.0 ug DNA	EUR 95

GPR78 ELISA Kit (Human) (OKCD08975)
OKCD08975	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The protein encoded by this gene belongs to the G protein-coupled receptor family, which contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. This is an orphan receptor, which displays significant level of constitutive activity. Association analysis shows preliminary evidence for the involvement of this gene in susceptibility to bipolar affective disorder and schizophrenia. Alternatively spliced transcript variants have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

GPR78 ELISA Kit (Human) (OKDD00294)
OKDD00294	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The protein encoded by this gene belongs to the G protein-coupled receptor family, which contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. This is an orphan receptor, which displays significant level of constitutive activity. Association analysis shows preliminary evidence for the involvement of this gene in susceptibility to bipolar affective disorder and schizophrenia. Alternatively spliced transcript variants have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.059 ng/mL

G Protein Coupled Receptor 78 (GPR78) Antibody
20-abx176531	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

G Protein Coupled Receptor 78 (GPR78) Antibody
20-abx212071	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

G Protein Coupled Receptor 78 (GPR78) Antibody
20-abx125903	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

G Protein Coupled Receptor 78 (GPR78) Antibody
20-abx172496	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

G Protein Coupled Receptor 78 (GPR78) Antibody
abx029634-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

G Protein Coupled Receptor 78 (GPR78) Antibody
abx029634-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

GPR78 sgRNA CRISPR Lentivector set (Human)
K0893001	ABM	3 x 1.0 ug	EUR 339

GPR78 sgRNA CRISPR Lentivector (Human) (Target 1)
K0893002	ABM	1.0 ug DNA	EUR 154

GPR78 sgRNA CRISPR Lentivector (Human) (Target 2)
K0893003	ABM	1.0 ug DNA	EUR 154

GPR78 sgRNA CRISPR Lentivector (Human) (Target 3)
K0893004	ABM	1.0 ug DNA	EUR 154

GPR78 Protein Vector (Human) (pPB-C-His)
PV018525	ABM	500 ng	EUR 329

GPR78 Protein Vector (Human) (pPB-N-His)
PV018526	ABM	500 ng	EUR 329

GPR78 Protein Vector (Human) (pPM-C-HA)
PV018527	ABM	500 ng	EUR 329

GPR78 Protein Vector (Human) (pPM-C-His)
PV018528	ABM	500 ng	EUR 329

GPR78 3'UTR GFP Stable Cell Line
TU059181	ABM	1.0 ml	EUR 1521

GPR78 3'UTR Luciferase Stable Cell Line
TU009181	ABM	1.0 ml	EUR 1521

Human G Protein Coupled Receptor 78 (GPR78) Protein
20-abx653490	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit
20-abx151720	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human G- protein coupled receptor 78, GPR78 ELISA KIT
ELI-09605h	Lifescience Market	96 Tests	EUR 824

Human G Protein Coupled Receptor 78 (GPR78) CLIA Kit
20-abx495281	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit
SEG738Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human G Protein Coupled Receptor 78 (GPR78) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human G Protein Coupled Receptor 78 (GPR78) in Tissue homogenates and other biological fluids.

GPR78 Rabbit Polyclonal Antibody