GNAI1 Rabbit Polyclonal Antibody

GNAI1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    GNAI1 Polyclonal Antibody

    ABP58653-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human GNAI1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of GNAI1 from Human, Mouse, Rat. This GNAI1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNAI1 protein

    GNAI1 Polyclonal Antibody

    ABP58653-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human GNAI1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of GNAI1 from Human, Mouse, Rat. This GNAI1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNAI1 protein

    GNAI1 Polyclonal Antibody

    ABP58653-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human GNAI1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of GNAI1 from Human, Mouse, Rat. This GNAI1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNAI1 protein

    GNAI1 Polyclonal Antibody

    ES11882-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against GNAI1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    GNAI1 Polyclonal Antibody

    ES11882-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against GNAI1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    GNAI1 Rabbit pAb

    A8844-100ul 100 ul
    EUR 308

    GNAI1 Rabbit pAb

    A8844-200ul 200 ul
    EUR 459

    GNAI1 Rabbit pAb

    A8844-20ul 20 ul
    EUR 183

    GNAI1 Rabbit pAb

    A8844-50ul 50 ul
    EUR 223

    GNAI1 Rabbit pAb

    A17388-100ul 100 ul Ask for price

    GNAI1 Rabbit pAb

    A17388-200ul 200 ul Ask for price

    GNAI1 Rabbit pAb

    A17388-20ul 20 ul Ask for price

    GNAI1 Rabbit pAb

    A17388-50ul 50 ul
    EUR 384

    GNAI1 Polyclonal Conjugated Antibody

    C31642 100ul
    EUR 397

    GNAI1 Polyclonal Conjugated Antibody

    C31909 100ul
    EUR 397

    GNAI1 antibody

    70R-17519 50 ul
    EUR 435
    Description: Rabbit polyclonal GNAI1 antibody

    GNAI1 antibody

    70R-2047 50 ug
    EUR 467
    Description: Rabbit polyclonal GNAI1 antibody

    GNAI1 antibody

    31909-100ul 100ul
    EUR 252

    GNAI1 antibody

    31909-50ul 50ul
    EUR 187

    GNAI1 antibody

    70R-49798 100 ul
    EUR 244
    Description: Purified Polyclonal GNAI1 antibody

    GNAI1 Antibody

    1-CSB-PA009588GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against GNAI1. Recognizes GNAI1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

    Gnai1/ Rat Gnai1 ELISA Kit

    ELI-27929r 96 Tests
    EUR 886

    anti- GNAI1 antibody

    FNab03531 100µg
    EUR 505.25
    • Immunogen: guanine nucleotide binding protein(G protein), alpha inhibiting activity polypeptide 1
    • Uniprot ID: P63096
    • Gene ID: 2770
    • Research Area: Signal Transduction
    Description: Antibody raised against GNAI1

    Anti-GNAI1 antibody

    PAab03531 100 ug
    EUR 355

    Anti-GNAI1 antibody

    STJ116332 100 µl
    EUR 277
    Description: Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene.

    Anti-GNAI1 antibody

    STJ119511 50 µl
    EUR 393
    Description: Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene.

    Anti-GNAI1 antibody

    STJ193040 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to GNAI1

    GNAI1 siRNA

    20-abx902212
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    GNAI1 Protein

    20-abx262917
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.

    GNAI1 siRNA

    20-abx918142
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    GNAI1 siRNA

    20-abx918143
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    GNAI1 Blocking Peptide

    33R-10215 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAI1 antibody, catalog no. 70R-2047

    GNAI1 Blocking Peptide

    20-abx062673
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.

    GNAI1 cloning plasmid

    CSB-CL009588HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1065
    • Sequence: atgggctgcacgctgagcgccgaggacaaggcggcggtggagcggagtaagatgatcgaccgcaacctccgtgaggacggcgagaaggcggcgcgcgaggtcaagctgctgctgctcggtgctggtgaatctggtaaaagtacaattgtgaagcagatgaaaattatccatgaag
    • Show more
    Description: A cloning plasmid for the GNAI1 gene.

    pBluescriptR-GNAI1 Plasmid

    PVT17029 2 ug
    EUR 325

    GNAI1 protein (His tag)

    80R-1980 50 ug
    EUR 322
    Description: Recombinant human GNAI1 protein (His tag)

    Chicken GNAI1 ELISA KIT

    ELI-08736c 96 Tests
    EUR 928

    Bovine GNAI1 ELISA KIT

    ELI-27342b 96 Tests
    EUR 928

    GNAI1 ELISA KIT|Human

    EF009906 96 Tests
    EUR 689

    Mouse Gnai1 ELISA KIT

    ELI-43677m 96 Tests
    EUR 865

    Rat GNAI1 shRNA Plasmid

    20-abx985222
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human GNAI1 shRNA Plasmid

    20-abx951841
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse GNAI1 shRNA Plasmid

    20-abx970574
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human GNAI1 ELISA KIT

    ELI-38025h 96 Tests
    EUR 824

    GNAI1 Recombinant Protein (Human)

    RP013462 100 ug Ask for price

    GNAI1 Recombinant Protein (Rat)

    RP202943 100 ug Ask for price

    GNAI1 Recombinant Protein (Mouse)

    RP138896 100 ug Ask for price

    Gnai1 ORF Vector (Rat) (pORF)

    ORF067649 1.0 ug DNA
    EUR 506

    GNAI1 ORF Vector (Human) (pORF)

    ORF004488 1.0 ug DNA
    EUR 95

    Gnai1 ORF Vector (Mouse) (pORF)

    ORF046300 1.0 ug DNA
    EUR 506

    guanine nucleotide binding protein alpha inhibiting activity polypeptide 1 (GNAI1) polyclonal antibody

    ABP-PAB-11315 100 ug Ask for price
      • Product line: Miscellaneous
      • Brand:

    Monoclonal GNAI1 / Gi Antibody (clone R4.5), Clone: R4.5

    APR16182G 0.05ml
    EUR 484
    Description: A Monoclonal antibody against Human GNAI1 / Gi (clone R4.5). The antibodies are raised in Mouse and are from clone R4.5. This antibody is applicable in WB and IHC-P

    Monoclonal GNAI1 Antibody (monoclonal) (M01), Clone: 2B8-2A5

    APR16183G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human GNAI1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2B8-2A5. This antibody is applicable in WB and IHC, E

    Gnai1 sgRNA CRISPR Lentivector set (Rat)

    K6775801 3 x 1.0 ug
    EUR 339

    Gnai1 sgRNA CRISPR Lentivector set (Mouse)

    K3829301 3 x 1.0 ug
    EUR 339

    GNAI1 sgRNA CRISPR Lentivector set (Human)

    K0874501 3 x 1.0 ug
    EUR 339

    Gnai1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6775802 1.0 ug DNA
    EUR 154

    Gnai1 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6775803 1.0 ug DNA
    EUR 154

    Gnai1 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6775804 1.0 ug DNA
    EUR 154

    Gnai1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3829302 1.0 ug DNA
    EUR 154

    GNAI1 Rabbit Polyclonal Antibody