NOXA1 Rabbit Polyclonal Antibody

NOXA1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    NOXA1 Polyclonal Antibody

    ABP59499-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human NOXA1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of NOXA1 from Human. This NOXA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOXA1 protein

    NOXA1 Polyclonal Antibody

    ES11975-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NOXA1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    NOXA1 Polyclonal Antibody

    ES11975-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NOXA1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    NOXA1 Rabbit pAb

    A13844-100ul 100 ul
    EUR 308

    NOXA1 Rabbit pAb

    A13844-200ul 200 ul
    EUR 459

    NOXA1 Rabbit pAb

    A13844-20ul 20 ul
    EUR 183

    NOXA1 Rabbit pAb

    A13844-50ul 50 ul
    EUR 223

    NOXA1 Polyclonal Conjugated Antibody

    C28378 100ul
    EUR 397

    NOXA1 Antibody

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NOXA1. Recognizes NOXA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

    Polyclonal NOXA1 Antibody (C-term)

    APR10900G 0.1ml
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOXA1 (C-term). This antibody is tested and proven to work in the following applications:

    Noxa1/ Rat Noxa1 ELISA Kit

    ELI-36921r 96 Tests
    EUR 886

    Anti-NOXA1 Antibody

    PA1930 100ug/vial
    EUR 294

    Anti-NOXA1 antibody

    STJ115784 100 µl
    EUR 277
    Description: This gene encodes a protein which activates NADPH oxidases, enzymes which catalyze a reaction generating reactive oxygen species. The encoded protein contains four N-terminal tetratricopeptide domains and a C-terminal Src homology 3 domain. Interaction between the encoded protein and proteins in the oxidase regulatory complex occur via the tetratricopeptide domains. Multiple transcript variants encoding different isoforms have been found for this gene.

    Anti-NOXA1 antibody

    STJ193133 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to NOXA1

    NOXA1 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    NOXA1 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    NOXA1 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.


    YF-PA17231 50 ug
    EUR 363
    Description: Mouse polyclonal to NOXA1


    YF-PA17232 100 ul
    EUR 403
    Description: Rabbit polyclonal to NOXA1


    YF-PA17233 100 ug
    EUR 403
    Description: Rabbit polyclonal to NOXA1

    NOXA1 Antibody, HRP conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NOXA1. Recognizes NOXA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    NOXA1 Antibody, FITC conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NOXA1. Recognizes NOXA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    NOXA1 Antibody, Biotin conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NOXA1. Recognizes NOXA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    NOXA1 cloning plasmid

    CSB-CL015963HU-10ug 10ug
    EUR 516
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1452
    • Sequence: atggcctctctgggggacctggtgcgcgcctggcacctgggcgcgcaggctgtggatcgtggggactgggcccgcgccttgcacctcttctcgggcgtcccggcgccgcccgccaggctgtgcttcaacgcgggctgcgtgcacctgctggccggggaccccgaggccgcgctgc
    • Show more
    Description: A cloning plasmid for the NOXA1 gene.


    EF005325 96 Tests
    EUR 689

    Rat NOXA1 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human NOXA1 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse NOXA1 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    NOXA1 Recombinant Protein (Human)

    RP021502 100 ug Ask for price

    NOXA1 Recombinant Protein (Mouse)

    RP154640 100 ug Ask for price

    NOXA1 Recombinant Protein (Mouse)

    RP154643 100 ug Ask for price

    NOXA1 Recombinant Protein (Rat)

    RP214277 100 ug Ask for price

    NADPH Oxidase Activator 1 (NOXA1) Antibody

    abx122122-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    NADPH Oxidase Activator 1 (NOXA1) Antibody

    abx034428-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    NADPH Oxidase Activator 1 (NOXA1) Antibody

    abx034428-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    NADPH Oxidase Activator 1 (NOXA1) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    NADPH Oxidase Activator 1 (NOXA1) Antibody (HRP)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    NADPH Oxidase Activator 1 (NOXA1) Antibody (FITC)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    NADPH Oxidase Activator 1 (NOXA1) Antibody (Biotin)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Noxa1 ORF Vector (Rat) (pORF)

    ORF071427 1.0 ug DNA
    EUR 506

    NOXA1 ORF Vector (Human) (pORF)

    ORF007168 1.0 ug DNA
    EUR 95

    Noxa1 ORF Vector (Mouse) (pORF)

    ORF051548 1.0 ug DNA
    EUR 506

    Noxa1 ORF Vector (Mouse) (pORF)

    ORF051549 1.0 ug DNA
    EUR 506

    Noxa1 sgRNA CRISPR Lentivector set (Rat)

    K6254801 3 x 1.0 ug
    EUR 339

    Noxa1 sgRNA CRISPR Lentivector set (Mouse)

    K3586301 3 x 1.0 ug
    EUR 339

    NOXA1 sgRNA CRISPR Lentivector set (Human)

    K1443401 3 x 1.0 ug
    EUR 339

    Noxa1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6254802 1.0 ug DNA
    EUR 154

    Noxa1 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6254803 1.0 ug DNA
    EUR 154

    NOXA1 Rabbit Polyclonal Antibody