XPO7 Rabbit Polyclonal Antibody

XPO7 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    XPO7 Polyclonal Antibody

    ABP60938-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human XPO7 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of XPO7 from Human, Mouse. This XPO7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human XPO7 protein

    XPO7 Polyclonal Antibody

    ABP60938-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human XPO7 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of XPO7 from Human, Mouse. This XPO7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human XPO7 protein

    XPO7 Polyclonal Antibody

    ABP60938-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human XPO7 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of XPO7 from Human, Mouse. This XPO7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human XPO7 protein

    XPO7 Polyclonal Antibody

    29726-100ul 100ul
    EUR 252

    XPO7 Polyclonal Antibody

    29726-50ul 50ul
    EUR 187

    XPO7 Rabbit pAb

    A16108-100ul 100 ul
    EUR 308

    XPO7 Rabbit pAb

    A16108-200ul 200 ul
    EUR 459

    XPO7 Rabbit pAb

    A16108-20ul 20 ul
    EUR 183

    XPO7 Rabbit pAb

    A16108-50ul 50 ul
    EUR 223

    XPO7 Polyclonal Conjugated Antibody

    C29726 100ul
    EUR 397

    XPO7 antibody

    70R-21345 50 ul
    EUR 435
    Description: Rabbit polyclonal XPO7 antibody

    XPO7 Antibody

    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against XPO7. Recognizes XPO7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    anti- XPO7 antibody

    FNab09551 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500-1:5000
    • Immunogen: exportin 7
    • Uniprot ID: Q9UIA9
    • Gene ID: 23039
    • Research Area: Signal Transduction
    Description: Antibody raised against XPO7

    Anti-XPO7 antibody

    PAab09551 100 ug
    EUR 355

    Anti-XPO7 antibody

    STJ118561 100 µl
    EUR 277

    Anti-XPO7 antibody

    STJ192984 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to XPO7

    XPO7 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    XPO7 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Exportin 7 (XPO7) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Exportin-7 (XPO7) Antibody

    abx239551-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    XPO7 cloning plasmid

    CSB-CL887065HU-10ug 10ug
    EUR 1197
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 3264
    • Sequence: atggcggatcatgtgcagagcctggcccaactagagaatctgtgcaaacagctgtatgaaaccacagacacaaccactcgactccaggcagagaaagccttggttgaatttaccaacagccctgattgcctgagcaagtgccagctactcctcgaaagaggaagttcctcttact
    • Show more
    Description: A cloning plasmid for the XPO7 gene.

    Mouse XPO7 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    XPO7 ELISA KIT|Human

    EF004324 96 Tests
    EUR 689

    Human XPO7 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    XPO7 ORF Vector (Human) (pORF)

    ORF011650 1.0 ug DNA
    EUR 95

    Xpo7 ORF Vector (Mouse) (pORF)

    ORF061969 1.0 ug DNA
    EUR 506

    Human Exportin- 7, XPO7 ELISA KIT

    ELI-17964h 96 Tests
    EUR 824

    Mouse Exportin- 7, Xpo7 ELISA KIT

    ELI-22387m 96 Tests
    EUR 865

    Chicken Exportin- 7, XPO7 ELISA KIT

    ELI-14975c 96 Tests
    EUR 928

    Human Exportin-7 (XPO7) ELISA Kit

    abx384333-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    XPO7 sgRNA CRISPR Lentivector set (Human)

    K2651001 3 x 1.0 ug
    EUR 339

    Xpo7 sgRNA CRISPR Lentivector set (Mouse)

    K4600201 3 x 1.0 ug
    EUR 339

    Human Exportin 7(XPO7)ELISA Kit

    QY-E01488 96T
    EUR 361

    XPO7 sgRNA CRISPR Lentivector (Human) (Target 1)

    K2651002 1.0 ug DNA
    EUR 154

    XPO7 sgRNA CRISPR Lentivector (Human) (Target 2)

    K2651003 1.0 ug DNA
    EUR 154

    XPO7 sgRNA CRISPR Lentivector (Human) (Target 3)

    K2651004 1.0 ug DNA
    EUR 154

    Xpo7 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4600202 1.0 ug DNA
    EUR 154

    Xpo7 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4600203 1.0 ug DNA
    EUR 154

    Xpo7 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4600204 1.0 ug DNA
    EUR 154

    XPO7 Protein Vector (Human) (pPB-C-His)

    PV046597 500 ng
    EUR 329

    XPO7 Protein Vector (Human) (pPB-N-His)

    PV046598 500 ng
    EUR 329

    XPO7 Protein Vector (Human) (pPM-C-HA)

    PV046599 500 ng
    EUR 329

    XPO7 Protein Vector (Human) (pPM-C-His)

    PV046600 500 ng
    EUR 329

    XPO7 Protein Vector (Mouse) (pPB-C-His)

    PV247874 500 ng
    EUR 1065

    XPO7 Protein Vector (Mouse) (pPB-N-His)

    PV247875 500 ng
    EUR 1065

    XPO7 Protein Vector (Mouse) (pPM-C-HA)

    PV247876 500 ng
    EUR 1065

    XPO7 Protein Vector (Mouse) (pPM-C-His)

    PV247877 500 ng
    EUR 1065

    Xpo7 3'UTR GFP Stable Cell Line

    TU172395 1.0 ml Ask for price

    XPO7 3'UTR GFP Stable Cell Line

    TU078607 1.0 ml
    EUR 1521

    Xpo7 3'UTR Luciferase Stable Cell Line

    TU122395 1.0 ml Ask for price

    XPO7 3'UTR Luciferase Stable Cell Line

    TU028607 1.0 ml
    EUR 1521

    VEGF Rabbit Polyclonal Antibody

    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    VEGF Rabbit Polyclonal Antibody

    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    IkB ? Rabbit Polyclonal Antibody

    ES8561-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    IkB ? Rabbit Polyclonal Antibody

    ES8561-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JAK1 Rabbit Polyclonal Antibody

    ES8562-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK1 Rabbit Polyclonal Antibody

    ES8562-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK2 Rabbit Polyclonal Antibody

    ES8563-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK2 Rabbit Polyclonal Antibody

    ES8563-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JNK2 Rabbit Polyclonal Antibody

    ES8564-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JNK2 Rabbit Polyclonal Antibody

    ES8564-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JNK3 Rabbit Polyclonal Antibody

    ES8565-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JNK3 Rabbit Polyclonal Antibody

    ES8565-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    MEK2 Rabbit Polyclonal Antibody

    ES8566-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

    MEK2 Rabbit Polyclonal Antibody

    ES8566-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

    MEK3 Rabbit Polyclonal Antibody

    ES8567-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    MEK3 Rabbit Polyclonal Antibody

    ES8567-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Nrf2 Rabbit Polyclonal Antibody

    ES8568-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Nrf2 Rabbit Polyclonal Antibody

    ES8568-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4a Rabbit Polyclonal Antibody

    ES8569-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4a Rabbit Polyclonal Antibody

    ES8569-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4b Rabbit Polyclonal Antibody

    ES8570-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4b Rabbit Polyclonal Antibody

    ES8570-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4c Rabbit Polyclonal Antibody

    ES8571-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4c Rabbit Polyclonal Antibody

    ES8571-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG5 Rabbit Polyclonal Antibody

    ES8572-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG5 Rabbit Polyclonal Antibody

    ES8572-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG7 Rabbit Polyclonal Antibody

    ES8573-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG7 Rabbit Polyclonal Antibody

    ES8573-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8574-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8574-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8575-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8575-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG14L Rabbit Polyclonal Antibody

    ES8576-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG14L Rabbit Polyclonal Antibody

    ES8576-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8578-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8578-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8579-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8579-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    WIPI2 Rabbit Polyclonal Antibody

    ES8580-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    WIPI2 Rabbit Polyclonal Antibody

    ES8580-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Gab1 Rabbit Polyclonal Antibody

    ES8582-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Gab1 Rabbit Polyclonal Antibody

    ES8582-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ERK1 Rabbit Polyclonal Antibody

    ES8583-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ERK1 Rabbit Polyclonal Antibody

    ES8583-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Met Rabbit Polyclonal Antibody

    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    VEGF Rabbit Polyclonal Antibody

    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    CD10 Rabbit Polyclonal Antibody

    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    NM23A Rabbit Polyclonal Antibody

    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    ATM Rabbit Polyclonal Antibody

    ABP57463-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57463-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57463-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    JAK1 Rabbit Polyclonal Antibody

    ABP57569-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

    JAK1 Rabbit Polyclonal Antibody

    ABP57569-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

    JAK1 Rabbit Polyclonal Antibody

    ABP57569-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

    JAK2 Rabbit Polyclonal Antibody

    ABP57570-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

    JAK2 Rabbit Polyclonal Antibody

    ABP57570-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

    JAK2 Rabbit Polyclonal Antibody

    ABP57570-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

    JNK2 Rabbit Polyclonal Antibody

    ABP57571-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

    JNK2 Rabbit Polyclonal Antibody

    ABP57571-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

    JNK2 Rabbit Polyclonal Antibody

    ABP57571-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

    JNK3 Rabbit Polyclonal Antibody

    ABP57572-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

    JNK3 Rabbit Polyclonal Antibody

    ABP57572-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

    JNK3 Rabbit Polyclonal Antibody

    ABP57572-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

    MEK2 Rabbit Polyclonal Antibody

    ABP57573-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

    MEK2 Rabbit Polyclonal Antibody

    ABP57573-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

    MEK2 Rabbit Polyclonal Antibody

    ABP57573-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

    MEK3 Rabbit Polyclonal Antibody

    ABP57574-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

    MEK3 Rabbit Polyclonal Antibody

    ABP57574-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

    MEK3 Rabbit Polyclonal Antibody

    ABP57574-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

    Nrf2 Rabbit Polyclonal Antibody

    ABP57575-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

    Nrf2 Rabbit Polyclonal Antibody

    ABP57575-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

    Nrf2 Rabbit Polyclonal Antibody

    ABP57575-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

    ATG4a Rabbit Polyclonal Antibody

    ABP57576-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

    ATG4a Rabbit Polyclonal Antibody

    ABP57576-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

    ATG4a Rabbit Polyclonal Antibody

    ABP57576-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

    ATG4b Rabbit Polyclonal Antibody

    ABP57577-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

    ATG4b Rabbit Polyclonal Antibody

    ABP57577-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

    ATG4b Rabbit Polyclonal Antibody

    ABP57577-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

    ATG4c Rabbit Polyclonal Antibody

    ABP57578-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

    ATG4c Rabbit Polyclonal Antibody

    ABP57578-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

    ATG4c Rabbit Polyclonal Antibody

    ABP57578-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

    ATG5 Rabbit Polyclonal Antibody

    ABP57579-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

    ATG5 Rabbit Polyclonal Antibody

    ABP57579-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

    ATG5 Rabbit Polyclonal Antibody

    ABP57579-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

    ATG7 Rabbit Polyclonal Antibody

    ABP57580-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

    ATG7 Rabbit Polyclonal Antibody

    ABP57580-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

    ATG7 Rabbit Polyclonal Antibody

    ABP57580-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

    ATG13 Rabbit Polyclonal Antibody

    ABP57581-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57581-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57581-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57582-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57582-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57582-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG14L Rabbit Polyclonal Antibody

    ABP57583-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

    ATG14L Rabbit Polyclonal Antibody

    ABP57583-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

    ATG14L Rabbit Polyclonal Antibody

    ABP57583-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

    NBR1 Rabbit Polyclonal Antibody

    ABP57585-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    NBR1 Rabbit Polyclonal Antibody

    ABP57585-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    NBR1 Rabbit Polyclonal Antibody

    ABP57585-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    NBR1 Rabbit Polyclonal Antibody

    ABP57586-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    NBR1 Rabbit Polyclonal Antibody

    ABP57586-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    NBR1 Rabbit Polyclonal Antibody

    ABP57586-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    WIPI2 Rabbit Polyclonal Antibody

    ABP57587-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of WIPI2
    • Applications tips:
    Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

    WIPI2 Rabbit Polyclonal Antibody

    ABP57587-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of WIPI2
    • Applications tips:
    Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

    WIPI2 Rabbit Polyclonal Antibody

    ABP57587-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of WIPI2
    • Applications tips:
    Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

    FAK Rabbit Polyclonal Antibody

    ABP57588-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of FAK
    • Applications tips:
    Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

    FAK Rabbit Polyclonal Antibody

    ABP57588-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of FAK
    • Applications tips:
    Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

    FAK Rabbit Polyclonal Antibody

    ABP57588-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of FAK
    • Applications tips:
    Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

    Gab1 Rabbit Polyclonal Antibody

    ABP57589-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Gab1
    • Applications tips:
    Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

    Gab1 Rabbit Polyclonal Antibody

    ABP57589-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Gab1
    • Applications tips:
    Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

    Gab1 Rabbit Polyclonal Antibody

    ABP57589-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Gab1
    • Applications tips:
    Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

    ERK1 Rabbit Polyclonal Antibody

    ABP57590-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ERK1
    • Applications tips:
    Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

    ERK1 Rabbit Polyclonal Antibody

    ABP57590-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ERK1
    • Applications tips:
    Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

    ERK1 Rabbit Polyclonal Antibody

    ABP57590-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ERK1
    • Applications tips:
    Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

    GAPDH Rabbit Polyclonal Antibody

    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    Rabbit Hemoglobin Polyclonal Antibody

    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Alliinase Rabbit Polyclonal Antibody

    38042-100ul 100ul
    EUR 252

    Alliinase Rabbit Polyclonal Antibody

    38042-50ul 50ul
    EUR 187

    ECFP Rabbit Polyclonal Antibody

    38077-100ul 100ul
    EUR 252

    ECFP Rabbit Polyclonal Antibody

    38077-50ul 50ul
    EUR 187

    EYFP Rabbit Polyclonal Antibody

    38078-100ul 100ul
    EUR 252

    EYFP Rabbit Polyclonal Antibody

    38078-50ul 50ul
    EUR 187

    mOrange Rabbit Polyclonal Antibody

    38079-100ul 100ul
    EUR 252

    mOrange Rabbit Polyclonal Antibody

    38079-50ul 50ul
    EUR 187

    mStrawberry Rabbit Polyclonal Antibody

    38083-100ul 100ul
    EUR 252

    mStrawberry Rabbit Polyclonal Antibody

    38083-50ul 50ul
    EUR 187

    AmCyan Rabbit Polyclonal Antibody

    38086-100ul 100ul
    EUR 252

    XPO7 Rabbit Polyclonal Antibody