TRPM8 Rabbit Polyclonal Antibody
Contact Us Below To Order :
 TRPM8 Polyclonal Antibody |
|
ABP60770-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TRPM8 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of TRPM8 from Human, Mouse, Rat. This TRPM8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPM8 protein |
TRPM8 Polyclonal Antibody |
|
A51013 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 TRPM8 Rabbit pAb |
|
A12572-100ul |
Abclonal |
100 ul |
EUR 308 |
TRPM8 Rabbit pAb |
|
A12572-200ul |
Abclonal |
200 ul |
EUR 459 |
TRPM8 Rabbit pAb |
|
A12572-20ul |
Abclonal |
20 ul |
EUR 183 |
TRPM8 Rabbit pAb |
|
A12572-50ul |
Abclonal |
50 ul |
EUR 223 |
 TRPM8 Rabbit mAb |
|
A4269-100ul |
Abclonal |
100 ul |
EUR 410 |
TRPM8 Rabbit mAb |
|
A4269-200ul |
Abclonal |
200 ul |
EUR 571 |
TRPM8 Rabbit mAb |
|
A4269-20ul |
Abclonal |
20 ul |
EUR 221 |
TRPM8 Rabbit mAb |
|
A4269-50ul |
Abclonal |
50 ul |
EUR 287 |
TRPM8 Rabbit pAb |
|
A5333-100ul |
Abclonal |
100 ul |
EUR 308 |
TRPM8 Rabbit pAb |
|
A5333-200ul |
Abclonal |
200 ul |
EUR 459 |
TRPM8 Rabbit pAb |
|
A5333-20ul |
Abclonal |
20 ul |
EUR 183 |
TRPM8 Rabbit pAb |
|
A5333-50ul |
Abclonal |
50 ul |
EUR 223 |
 Antibody) Polyclonal TRPM8 (extracellular) Antibody |
|
APR10553G |
Leading Biology |
0.05ml |
EUR 659 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPM8 (extracellular) . This antibody is tested and proven to work in the following applications: |
) Polyclonal TRPM8 Antibody (Center) |
|
APR10555G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPM8 (Center). This antibody is tested and proven to work in the following applications: |
 TRPM8 antibody |
|
70R-51094 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal TRPM8 antibody |
TRPM8 antibody |
|
70R-5149 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal TRPM8 antibody raised against the N terminal of TRPM8 |
 TRPM8 Antibody |
|
36613-100ul |
SAB |
100ul |
EUR 252 |
TRPM8 Antibody |
|
DF7966 |
Affbiotech |
200ul |
EUR 304 |
|
Description: TRPM8 Antibody detects endogenous levels of total TRPM8. |
TRPM8 Antibody |
|
1-CSB-PA969456 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against TRPM8. Recognizes TRPM8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
TRPM8 Antibody |
|
1-CSB-PA768757ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against TRPM8. Recognizes TRPM8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
TRPM8 Antibody |
|
1-CSB-PA768757LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TRPM8. Recognizes TRPM8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
TRPM8 Antibody |
|
1-CSB-PA072616 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against TRPM8. Recognizes TRPM8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
) Polyclonal TRPM8 Antibody (N-Terminus) |
|
APR10541G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPM8 (N-Terminus). This antibody is tested and proven to work in the following applications: |
) Polyclonal TRPM8 Antibody (Center R536) |
|
APR10554G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPM8 (Center R536). This antibody is tested and proven to work in the following applications: |
) Polyclonal TRPM8 Antibody (internal region) |
|
APR10556G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TRPM8 (internal region). This antibody is tested and proven to work in the following applications: |
 TRPM8 Polyclonal Antibody, HRP Conjugated |
|
A51014 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 TRPM8 Polyclonal Antibody, FITC Conjugated |
|
A51015 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 TRPM8 Polyclonal Antibody, Biotin Conjugated |
|
A51016 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 TRPM8 Conjugated Antibody |
|
C36613 |
SAB |
100ul |
EUR 397 |
 anti- TRPM8 antibody |
|
FNab09023 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: transient receptor potential cation channel, subfamily M, member 8
- Uniprot ID: Q7Z2W7
- Gene ID: 79054
- Research Area: Neuroscience
|
|
Description: Antibody raised against TRPM8 |
 Anti-TRPM8 Antibody |
|
PB9837 |
BosterBio |
100ug/vial |
EUR 294 |
 Anti-TRPM8 antibody |
|
STJ193104 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to TRPM8 |
 TRPM8 siRNA |
|
20-abx905813 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRPM8 siRNA |
|
20-abx938235 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRPM8 siRNA |
|
20-abx938236 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 TRPM8 Antibody, HRP conjugated |
|
1-CSB-PA768757LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TRPM8. Recognizes TRPM8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 TRPM8 Antibody, FITC conjugated |
|
1-CSB-PA768757LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TRPM8. Recognizes TRPM8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 TRPM8 Antibody, Biotin conjugated |
|
1-CSB-PA768757LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against TRPM8. Recognizes TRPM8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Anti-TRPM8 Monoclonal Antibody |
|
M01002 |
BosterBio |
100ug |
EUR 397 |
|
Description: Rabbit Monoclonal TRPM8 Antibody. Validated in IF, ICC, WB and tested in Human, Mouse. |
 TRPM8 Blocking Peptide |
|
20-abx063969 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRPM8 Blocking Peptide |
|
33R-10139 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRPM8 antibody, catalog no. 70R-5149 |
TRPM8 Blocking Peptide |
|
DF7966-BP |
Affbiotech |
1mg |
EUR 195 |
 TRPM8 cloning plasmid |
|
CSB-CL768757HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 579
- Sequence: atgaaatccttccttcctgtccacaccatcgtgcttatcagggagaatgtgtgcaagtgtggctatgcccagagccagcacatggaaggcacccagatcaaccaaagtgagaaatggaactacaagaaacacaccaaggaatttcctaccgacgcctttggggatattcagtttga
- Show more
|
|
Description: A cloning plasmid for the TRPM8 gene. |
TRPM8 cloning plasmid |
|
CSB-CL768757HU2-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2049
- Sequence: atgcaggccatcaatacctccatcaaaaataaaattccttgtgtggtggtggaaggctcgggccagatcgctgatgtgatcgctagcctggtggaggtggaggatgccctgacatcttctgccgtcaaggagaagctggtgcgctttttaccccgcacggtgtcccggctgcctg
- Show more
|
|
Description: A cloning plasmid for the TRPM8 gene. |
 Mouse TRPM8 shRNA Plasmid |
|
20-abx980385 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat TRPM8 shRNA Plasmid |
|
20-abx987748 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human TRPM8 shRNA Plasmid |
|
20-abx962280 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Antibody) TRPM8 Channel-Associated Factor 1 (FAM115A) Antibody |
|
abx340169-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
 Antibody) TRPM8 Channel-Associated Factor 2 (FAM115C) Antibody |
|
abx340170-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
 (pORF)) Trpm8 ORF Vector (Rat) (pORF) |
|
ORF078295 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) TRPM8 ORF Vector (Human) (pORF) |
|
ORF011026 |
ABM |
1.0 ug DNA |
EUR 95 |
TRPM8 ORF Vector (Human) (pORF) |
|
ORF014837 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Trpm8 ORF Vector (Mouse) (pORF) |
|
ORF060530 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKCD01884)) TRPM8 ELISA Kit (Human) (OKCD01884) |
|
OKCD01884 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
|
Description: Description of target: Receptor-activated non-selective cation channel involved in detection of sensations such as coolness, by being activated by cold temperature below 25 degrees Celsius. Activated by icilin, eucalyptol, menthol, cold and modulation of intracellular pH. Involved in menthol sensation. Permeable for monovalent cations sodium, potassium, and cesium and divalent cation calcium. Temperature sensing is tightly linked to voltage-dependent gating. Activated upon depolarization, changes in temperature resulting in graded shifts of its voltage-dependent activation curves. The chemical agonist menthol functions as a gating modifier, shifting activation curves towards physiological membrane potentials. Temperature sensitivity arises from a tenfold difference in the activation energies associated with voltage-dependent opening and closing. In prostate cancer cells, shows strong inward rectification and high calcium selectivity in contrast to its behavior in normal cells which is characterized by outward rectification and poor cationic selectivity. Plays a role in prostate cancer cell migration.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL |
 polyclonal antibody) Transient receptor potential cation channel subfamily M member 8 (TRPM8) polyclonal antibody |
|
ABP-PAB-10282 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Cell Surface Molecules / GPCRs
- Brand:
|
) TRPM8 sgRNA CRISPR Lentivector set (Human) |
|
K2536601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Trpm8 sgRNA CRISPR Lentivector set (Mouse) |
|
K4034001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Trpm8 sgRNA CRISPR Lentivector set (Rat) |
|
K7013401 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) TRPM8 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2536602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) TRPM8 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2536603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) TRPM8 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2536604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Trpm8 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4034002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Trpm8 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4034003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Trpm8 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4034004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Trpm8 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7013402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Trpm8 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7013403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Trpm8 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7013404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) TRPM8 Protein Vector (Human) (pPB-C-His) |
|
PV059345 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) TRPM8 Protein Vector (Human) (pPB-N-His) |
|
PV059346 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) TRPM8 Protein Vector (Human) (pPM-C-HA) |
|
PV059347 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) TRPM8 Protein Vector (Human) (pPM-C-His) |
|
PV059348 |
ABM |
500 ng |
EUR 481 |
TRPM8 Protein Vector (Human) (pPB-C-His) |
|
PV044101 |
ABM |
500 ng |
EUR 329 |
TRPM8 Protein Vector (Human) (pPB-N-His) |
|
PV044102 |
ABM |
500 ng |
EUR 329 |
TRPM8 Protein Vector (Human) (pPM-C-HA) |
|
PV044103 |
ABM |
500 ng |
EUR 329 |
TRPM8 Protein Vector (Human) (pPM-C-His) |
|
PV044104 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) TRPM8 Protein Vector (Rat) (pPB-C-His) |
|
PV313178 |
ABM |
500 ng |
EUR 1191 |
 (pPB-N-His)) TRPM8 Protein Vector (Rat) (pPB-N-His) |
|
PV313179 |
ABM |
500 ng |
EUR 1191 |
 (pPM-C-HA)) TRPM8 Protein Vector (Rat) (pPM-C-HA) |
|
PV313180 |
ABM |
500 ng |
EUR 1191 |
 (pPM-C-His)) TRPM8 Protein Vector (Rat) (pPM-C-His) |
|
PV313181 |
ABM |
500 ng |
EUR 1191 |
 (pPB-C-His)) TRPM8 Protein Vector (Mouse) (pPB-C-His) |
|
PV242118 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) TRPM8 Protein Vector (Mouse) (pPB-N-His) |
|
PV242119 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) TRPM8 Protein Vector (Mouse) (pPM-C-HA) |
|
PV242120 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) TRPM8 Protein Vector (Mouse) (pPM-C-His) |
|
PV242121 |
ABM |
500 ng |
EUR 1065 |
 Trpm8 3'UTR GFP Stable Cell Line |
|
TU171193 |
ABM |
1.0 ml |
Ask for price |
 TRPM8 3'UTR GFP Stable Cell Line |
|
TU077266 |
ABM |
1.0 ml |
EUR 1521 |
 Trpm8 3'UTR Luciferase Stable Cell Line |
|
TU121193 |
ABM |
1.0 ml |
Ask for price |
 TRPM8 3'UTR Luciferase Stable Cell Line |
|
TU027266 |
ABM |
1.0 ml |
EUR 1521 |
Trpm8 3'UTR Luciferase Stable Cell Line |
|
TU222512 |
ABM |
1.0 ml |
Ask for price |
Trpm8 3'UTR GFP Stable Cell Line |
|
TU272512 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
TRPM8 Rabbit Polyclonal Antibody
