DTL Rabbit Polyclonal Antibody

DTL Rabbit Polyclonal Antibody

Contact Us Below To Order :

DTL Polyclonal Antibody
ABP58429-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human DTL protein Applications tips:
Description: A polyclonal antibody for detection of DTL from Human, Mouse. This DTL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DTL protein

DTL Polyclonal Antibody
ES11892-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against DTL from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DTL Polyclonal Antibody
ES11892-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against DTL from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DTL Rabbit pAb
A12150-100ul	Abclonal	100 ul	EUR 308

DTL Rabbit pAb
A12150-200ul	Abclonal	200 ul	EUR 459

DTL Rabbit pAb
A12150-20ul	Abclonal	20 ul	EUR 183

DTL Rabbit pAb
A12150-50ul	Abclonal	50 ul	EUR 223

Polyclonal DTL Antibody (Center)
APR03505G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DTL (Center). This antibody is tested and proven to work in the following applications:

DTL antibody
70R-16943	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DTL antibody

DTL antibody
70R-2405	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DTL antibody

DTL Antibody
46556-100ul	SAB	100ul	EUR 252

DTL Antibody
1-CSB-PA889160LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DTL. Recognizes DTL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DTL Antibody
abx122413-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

DTL Antibody
1-CSB-PA007215GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DTL. Recognizes DTL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DTL Antibody
abx232549-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

DTL Conjugated Antibody
C46556	SAB	100ul	EUR 397

DTL Antibody (HRP)
20-abx315547	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DTL Antibody (FITC)
20-abx315548	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DTL Antibody (Biotin)
20-abx315549	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

anti- DTL antibody
FNab02549	FN Test	100µg	EUR 505.25
Immunogen: denticleless homolog(Drosophila) Uniprot ID: Q9NZJ0 Gene ID: 51514 Research Area: Cell Division and Proliferation, Metabolism
Description: Antibody raised against DTL

Anti-DTL antibody
PAab02549	Lifescience Market	100 ug	EUR 355

Anti-DTL antibody
STJ114043	St John's Laboratory	100 µl	EUR 277

Anti-DTL antibody
STJ193050	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to DTL

DTL siRNA
20-abx914682	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DTL siRNA
20-abx914683	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-DTL
YF-PA19093	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to DTL

DTL Antibody, HRP conjugated
1-CSB-PA889160LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DTL. Recognizes DTL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DTL Antibody, FITC conjugated
1-CSB-PA889160LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DTL. Recognizes DTL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DTL Antibody, Biotin conjugated
1-CSB-PA889160LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DTL. Recognizes DTL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DTL Blocking Peptide
33R-9712	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DTL antibody, catalog no. 70R-2405

DTL cloning plasmid
CSB-CL889160HU1-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2193 Sequence: atgctcttcaattcggtgctccgccagccccagcttggcgtcctgagaaatggatggtcttcacaataccctcttcaatcccttctgactggttatcagtgcagtggtaatgatgaacacacttcttatggagaaacaggagtcccagttcctccttttggatgtaccttctctt Show more
Description: A cloning plasmid for the DTL gene.

DTL cloning plasmid
CSB-CL889160HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2193 Sequence: atgctcttcaattcggtgctccgccagccccagcttggcgtcctgagaaatggatggtcttcacaataccctcttcaatcccttctgactggttatcagtgcagtggtaatgatgaacacacttcttatggagaaacaggagtcccagttcctccttttggatgtaccttctctt Show more
Description: A cloning plasmid for the DTL gene.

Denticleless Protein Homolog (DTL) Antibody
abx026016-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Denticleless Protein Homolog (DTL) Antibody
abx026016-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Denticleless Homolog (Drosophila) (DTL) Antibody
20-abx112037	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Denticleless Protein Homolog (DTL) Antibody
20-abx125788	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Denticleless Protein Homolog (DTL) Antibody
20-abx301818	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DTL ELISA KIT|Human
EF009228	Lifescience Market	96 Tests	EUR 689

Mouse DTL shRNA Plasmid
20-abx978699	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human DTL shRNA Plasmid
20-abx959804	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pIRES2-EGFP-DTL Plasmid
PVTB00624-2a	Lifescience Market	2 ug	EUR 356

pCMV-SPORT6-DTL Plasmid
PVT16145	Lifescience Market	2 ug	EUR 325

DTL Recombinant Protein (Human)
RP009871	ABM	100 ug	Ask for price

DTL Recombinant Protein (Human)
RP009874	ABM	100 ug	Ask for price

DTL Recombinant Protein (Mouse)
RP130154	ABM	100 ug	Ask for price

DTL ORF Vector (Human) (pORF)
ORF003291	ABM	1.0 ug DNA	EUR 95

DTL ORF Vector (Human) (pORF)
ORF003292	ABM	1.0 ug DNA	EUR 95

Dtl ORF Vector (Mouse) (pORF)
ORF043386	ABM	1.0 ug DNA	EUR 506

DTL sgRNA CRISPR Lentivector set (Human)
K0635501	ABM	3 x 1.0 ug	EUR 339

Dtl sgRNA CRISPR Lentivector set (Mouse)
K4702501	ABM	3 x 1.0 ug	EUR 339

Mouse Sarcoma antigen S35, Dtl ELISA KIT
ELI-29540m	Lifescience Market	96 Tests	EUR 865

Human Denticleless protein homolog, DTL ELISA KIT
ELI-26129h	Lifescience Market	96 Tests	EUR 824

Chicken Denticleless protein homolog, DTL ELISA KIT
ELI-26661c	Lifescience Market	96 Tests	EUR 928

Mouse Denticleless protein homolog, Dtl ELISA KIT
ELI-26662m	Lifescience Market	96 Tests	EUR 865

DTL sgRNA CRISPR Lentivector (Human) (Target 1)
K0635502	ABM	1.0 ug DNA	EUR 154

DTL sgRNA CRISPR Lentivector (Human) (Target 2)
K0635503	ABM	1.0 ug DNA	EUR 154

DTL sgRNA CRISPR Lentivector (Human) (Target 3)
K0635504	ABM	1.0 ug DNA	EUR 154

Dtl sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4702502	ABM	1.0 ug DNA	EUR 154

Dtl sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4702503	ABM	1.0 ug DNA	EUR 154

Dtl sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4702504	ABM	1.0 ug DNA	EUR 154

DTL Protein Vector (Mouse) (pPB-C-His)
PV173542	ABM	500 ng	EUR 1065

DTL Protein Vector (Mouse) (pPB-N-His)
PV173543	ABM	500 ng	EUR 1065

DTL Protein Vector (Mouse) (pPM-C-HA)
PV173544	ABM	500 ng	EUR 1065

DTL Protein Vector (Mouse) (pPM-C-His)
PV173545	ABM	500 ng	EUR 1065

DTL Protein Vector (Human) (pPB-C-His)
PV013161	ABM	500 ng	EUR 329

DTL Protein Vector (Human) (pPB-N-His)
PV013162	ABM	500 ng	EUR 329

DTL Protein Vector (Human) (pPM-C-HA)
PV013163	ABM	500 ng	EUR 329

DTL Protein Vector (Human) (pPM-C-His)
PV013164	ABM	500 ng	EUR 329

DTL Protein Vector (Human) (pPB-C-His)
PV013165	ABM	500 ng	EUR 329

DTL Protein Vector (Human) (pPB-N-His)
PV013166	ABM	500 ng	EUR 329

DTL Protein Vector (Human) (pPM-C-HA)
PV013167	ABM	500 ng	EUR 329

DTL Protein Vector (Human) (pPM-C-His)
PV013168	ABM	500 ng	EUR 329

Dtl 3'UTR GFP Stable Cell Line
TU155419	ABM	1.0 ml	Ask for price

Dtl 3'UTR Luciferase Stable Cell Line
TU105419	ABM	1.0 ml	Ask for price

Dtl 3'UTR Luciferase Stable Cell Line
TU203661	ABM	1.0 ml	Ask for price

Dtl 3'UTR GFP Stable Cell Line
TU253661	ABM	1.0 ml	Ask for price

DTL 3'UTR GFP Stable Cell Line
TU056357	ABM	1.0 ml	EUR 1521

DTL 3'UTR Luciferase Stable Cell Line
TU006357	ABM	1.0 ml	EUR 1521

DTL Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV709467	ABM	1.0 ug DNA	EUR 316

DTL Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV709471	ABM	1.0 ug DNA	EUR 316

DTL Rabbit Polyclonal Antibody