DTL Rabbit Polyclonal Antibody

DTL Rabbit Polyclonal Antibody

Contact Us Below To Order :

    DTL Polyclonal Antibody

    ABP58429-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human DTL protein
    • Applications tips:
    Description: A polyclonal antibody for detection of DTL from Human, Mouse. This DTL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DTL protein

    DTL Polyclonal Antibody

    ES11892-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against DTL from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

    DTL Polyclonal Antibody

    ES11892-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against DTL from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

    DTL Rabbit pAb

    A12150-100ul 100 ul
    EUR 308

    DTL Rabbit pAb

    A12150-200ul 200 ul
    EUR 459

    DTL Rabbit pAb

    A12150-20ul 20 ul
    EUR 183

    DTL Rabbit pAb

    A12150-50ul 50 ul
    EUR 223

    Polyclonal DTL Antibody (Center)

    APR03505G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DTL (Center). This antibody is tested and proven to work in the following applications:

    DTL antibody

    70R-16943 50 ul
    EUR 435
    Description: Rabbit polyclonal DTL antibody

    DTL antibody

    70R-2405 50 ug
    EUR 467
    Description: Rabbit polyclonal DTL antibody

    DTL Antibody

    46556-100ul 100ul
    EUR 252

    DTL Antibody

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against DTL. Recognizes DTL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    DTL Antibody

    abx122413-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    DTL Antibody

    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against DTL. Recognizes DTL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    DTL Antibody

    abx232549-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    DTL Conjugated Antibody

    C46556 100ul
    EUR 397

    DTL Antibody (HRP)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    DTL Antibody (FITC)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    DTL Antibody (Biotin)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    anti- DTL antibody

    FNab02549 100µg
    EUR 505.25
    • Immunogen: denticleless homolog(Drosophila)
    • Uniprot ID: Q9NZJ0
    • Gene ID: 51514
    • Research Area: Cell Division and Proliferation, Metabolism
    Description: Antibody raised against DTL

    Anti-DTL antibody

    PAab02549 100 ug
    EUR 355

    Anti-DTL antibody

    STJ114043 100 µl
    EUR 277

    Anti-DTL antibody

    STJ193050 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to DTL

    DTL siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    DTL siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.


    YF-PA19093 100 ug
    EUR 403
    Description: Rabbit polyclonal to DTL

    DTL Antibody, HRP conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against DTL. Recognizes DTL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    DTL Antibody, FITC conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against DTL. Recognizes DTL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    DTL Antibody, Biotin conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against DTL. Recognizes DTL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    DTL Blocking Peptide

    33R-9712 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DTL antibody, catalog no. 70R-2405

    DTL cloning plasmid

    CSB-CL889160HU1-10ug 10ug
    EUR 474
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2193
    • Sequence: atgctcttcaattcggtgctccgccagccccagcttggcgtcctgagaaatggatggtcttcacaataccctcttcaatcccttctgactggttatcagtgcagtggtaatgatgaacacacttcttatggagaaacaggagtcccagttcctccttttggatgtaccttctctt
    • Show more
    Description: A cloning plasmid for the DTL gene.

    DTL cloning plasmid

    CSB-CL889160HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2193
    • Sequence: atgctcttcaattcggtgctccgccagccccagcttggcgtcctgagaaatggatggtcttcacaataccctcttcaatcccttctgactggttatcagtgcagtggtaatgatgaacacacttcttatggagaaacaggagtcccagttcctccttttggatgtaccttctctt
    • Show more
    Description: A cloning plasmid for the DTL gene.

    Denticleless Protein Homolog (DTL) Antibody

    abx026016-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Denticleless Protein Homolog (DTL) Antibody

    abx026016-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Denticleless Homolog (Drosophila) (DTL) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Denticleless Protein Homolog (DTL) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Denticleless Protein Homolog (DTL) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.


    EF009228 96 Tests
    EUR 689

    Mouse DTL shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human DTL shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    pIRES2-EGFP-DTL Plasmid

    PVTB00624-2a 2 ug
    EUR 356

    pCMV-SPORT6-DTL Plasmid

    PVT16145 2 ug
    EUR 325

    DTL Recombinant Protein (Human)

    RP009871 100 ug Ask for price

    DTL Recombinant Protein (Human)

    RP009874 100 ug Ask for price

    DTL Recombinant Protein (Mouse)

    RP130154 100 ug Ask for price

    DTL ORF Vector (Human) (pORF)

    ORF003291 1.0 ug DNA
    EUR 95

    DTL ORF Vector (Human) (pORF)

    ORF003292 1.0 ug DNA
    EUR 95

    Dtl ORF Vector (Mouse) (pORF)

    ORF043386 1.0 ug DNA
    EUR 506

    DTL sgRNA CRISPR Lentivector set (Human)

    K0635501 3 x 1.0 ug
    EUR 339

    Dtl sgRNA CRISPR Lentivector set (Mouse)

    K4702501 3 x 1.0 ug
    EUR 339

    Mouse Sarcoma antigen S35, Dtl ELISA KIT

    ELI-29540m 96 Tests
    EUR 865

    Human Denticleless protein homolog, DTL ELISA KIT

    ELI-26129h 96 Tests
    EUR 824

    Chicken Denticleless protein homolog, DTL ELISA KIT

    ELI-26661c 96 Tests
    EUR 928

    Mouse Denticleless protein homolog, Dtl ELISA KIT

    ELI-26662m 96 Tests
    EUR 865

    DTL sgRNA CRISPR Lentivector (Human) (Target 1)

    K0635502 1.0 ug DNA
    EUR 154

    DTL sgRNA CRISPR Lentivector (Human) (Target 2)

    K0635503 1.0 ug DNA
    EUR 154

    DTL sgRNA CRISPR Lentivector (Human) (Target 3)

    K0635504 1.0 ug DNA
    EUR 154

    Dtl sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4702502 1.0 ug DNA
    EUR 154

    Dtl sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4702503 1.0 ug DNA
    EUR 154

    Dtl sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4702504 1.0 ug DNA
    EUR 154

    DTL Protein Vector (Mouse) (pPB-C-His)

    PV173542 500 ng
    EUR 1065

    DTL Protein Vector (Mouse) (pPB-N-His)

    PV173543 500 ng
    EUR 1065

    DTL Protein Vector (Mouse) (pPM-C-HA)

    PV173544 500 ng
    EUR 1065

    DTL Protein Vector (Mouse) (pPM-C-His)

    PV173545 500 ng
    EUR 1065

    DTL Protein Vector (Human) (pPB-C-His)

    PV013161 500 ng
    EUR 329

    DTL Protein Vector (Human) (pPB-N-His)

    PV013162 500 ng
    EUR 329

    DTL Protein Vector (Human) (pPM-C-HA)

    PV013163 500 ng
    EUR 329

    DTL Protein Vector (Human) (pPM-C-His)

    PV013164 500 ng
    EUR 329

    DTL Protein Vector (Human) (pPB-C-His)

    PV013165 500 ng
    EUR 329

    DTL Protein Vector (Human) (pPB-N-His)

    PV013166 500 ng
    EUR 329

    DTL Protein Vector (Human) (pPM-C-HA)

    PV013167 500 ng
    EUR 329

    DTL Protein Vector (Human) (pPM-C-His)

    PV013168 500 ng
    EUR 329

    Dtl 3'UTR GFP Stable Cell Line

    TU155419 1.0 ml Ask for price

    Dtl 3'UTR Luciferase Stable Cell Line

    TU105419 1.0 ml Ask for price

    Dtl 3'UTR Luciferase Stable Cell Line

    TU203661 1.0 ml Ask for price

    Dtl 3'UTR GFP Stable Cell Line

    TU253661 1.0 ml Ask for price

    DTL 3'UTR GFP Stable Cell Line

    TU056357 1.0 ml
    EUR 1521

    DTL 3'UTR Luciferase Stable Cell Line

    TU006357 1.0 ml
    EUR 1521

    DTL Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

    LV709467 1.0 ug DNA
    EUR 316

    DTL Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

    LV709471 1.0 ug DNA
    EUR 316

    DTL Rabbit Polyclonal Antibody