IDH3G Rabbit Polyclonal Antibody

IDH3G Rabbit Polyclonal Antibody

Contact Us Below To Order :

    IDH3G Polyclonal Antibody
    ES11914-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against IDH3G from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
    IDH3G Polyclonal Antibody
    ES11914-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against IDH3G from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
    IDH3G Rabbit pAb
    A13745-100ul 100 ul
    EUR 308
    IDH3G Rabbit pAb
    A13745-200ul 200 ul
    EUR 459
    IDH3G Rabbit pAb
    A13745-20ul 20 ul
    EUR 183
    IDH3G Rabbit pAb
    A13745-50ul 50 ul
    EUR 223
    IDH3G antibody
    22354-100ul 100ul
    EUR 390
    IDH3G antibody
    70R-13062 100 ul
    EUR 457
    Description: Affinity purified Rabbit polyclonal IDH3G antibody
    IDH3G antibody
    70R-13542 100 ul
    EUR 457
    Description: Affinity purified Rabbit polyclonal IDH3G antibody
    IDH3G Antibody
    36158-100ul 100ul
    EUR 252
    IDH3G Antibody
    1-CSB-PA066473
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against IDH3G. Recognizes IDH3G from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
    IDH3G Antibody
    1-CSB-PA952993
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against IDH3G. Recognizes IDH3G from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
    IDH3G Antibody
    1-CSB-PA010993LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IDH3G. Recognizes IDH3G from Human. This antibody is Unconjugated. Tested in the following application: ELISA
    Polyclonal IDH3G Antibody (C-term)
    APR07938G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IDH3G (C-term). This antibody is tested and proven to work in the following applications:
    Polyclonal IDH3G Antibody (N-term)
    APR07939G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IDH3G (N-term). This antibody is tested and proven to work in the following applications:
    IDH3G Polyclonal Antibody, HRP Conjugated
    A56027 100 µg
    EUR 570.55
    Description: fast delivery possible
    IDH3G Polyclonal Antibody, FITC Conjugated
    A56028 100 µg
    EUR 570.55
    Description: reagents widely cited
    IDH3G Polyclonal Antibody, Biotin Conjugated
    A56029 100 µg
    EUR 570.55
    Description: Ask the seller for details
    IDH3G Conjugated Antibody
    C36158 100ul
    EUR 397
    anti- IDH3G antibody
    FNab04123 100µg
    EUR 548.75
    • Immunogen: isocitrate dehydrogenase 3(NAD+) gamma
    • Uniprot ID: P51553
    • Gene ID: 3421
    • Research Area: Metabolism
    Description: Antibody raised against IDH3G
    Anti-IDH3G antibody
    PAab04123 100 ug
    EUR 386
    Anti-IDH3G antibody
    STJ115696 100 µl
    EUR 277
    Description: Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the gamma subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. This gene is a candidate gene for periventricular heterotopia. Several alternatively spliced transcript variants of this gene have been described, but only some of their full length natures have been determined.
    Anti-IDH3G antibody
    STJ193072 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to IDH3G
    Polyclonal IDH3G (aa337-350) Antibody (internal region)
    APR07937G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IDH3G (aa337-350) (internal region). This antibody is tested and proven to work in the following applications:
    IDH3G siRNA
    20-abx920147
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    IDH3G siRNA
    20-abx920148
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    anti-IDH3G
    YF-PA12532 50 ug
    EUR 363
    Description: Mouse polyclonal to IDH3G
    anti-IDH3G
    YF-PA12533 100 ug
    EUR 403
    Description: Rabbit polyclonal to IDH3G
    anti-IDH3G
    YF-PA23948 50 ul
    EUR 334
    Description: Mouse polyclonal to IDH3G
    IDH3G Antibody, HRP conjugated
    1-CSB-PA010993LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IDH3G. Recognizes IDH3G from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    IDH3G Antibody, FITC conjugated
    1-CSB-PA010993LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IDH3G. Recognizes IDH3G from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    IDH3G Antibody, Biotin conjugated
    1-CSB-PA010993LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IDH3G. Recognizes IDH3G from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    IDH3G cloning plasmid
    CSB-CL010993HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1182
    • Sequence: atggcgctgaaggtagcgaccgtcgccggcagcgccgcgaaggcggtgctcgggccagcccttctctgccgtccctgggaggttctaggcgcccacgaggtcccctcgaggaacatcttttcagaacaaacaattcctccgtccgctaagtatggcgggcggcacacggtgacca
    • Show more
    Description: A cloning plasmid for the IDH3G gene.
    IDH3G cloning plasmid
    CSB-CL010993HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1182
    • Sequence: atggcgctgaaggtagcgaccgtcgccggcagcgccgcgaaggcggtgctcgggccagcccttctctgccgtccctgggaggttctaggcgcccacgaggtcccctcgaggaacatcttttcagaacaaacaattcctccgtccgctaagtatggcgggcggcacacggtgacca
    • Show more
    Description: A cloning plasmid for the IDH3G gene.
    pCMV-SPORT6-IDH3G
    PVT12596 2 ug
    EUR 391
    Anti-IDH3G (aa337-350) antibody
    STJ72611 100 µg
    EUR 359
    IDH3G protein (His tag)
    80R-2066 50 ug
    EUR 424
    Description: Recombinant human IDH3G protein (His tag)
    IDH3G ELISA KIT|Human
    EF010280 96 Tests
    EUR 689
    Human IDH3G shRNA Plasmid
    20-abx952316
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse IDH3G shRNA Plasmid
    20-abx970963
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    IDH3G Recombinant Protein (Human)
    RP015547 100 ug Ask for price
    IDH3G Recombinant Protein (Human)
    RP015550 100 ug Ask for price
    IDH3G Recombinant Protein (Rat)
    RP205457 100 ug Ask for price
    IDH3G Recombinant Protein (Mouse)
    RP142904 100 ug Ask for price
    Anti-IDH3G (2A2-1D3)
    YF-MA13645 100 ug
    EUR 363
    Description: Mouse monoclonal to IDH3G
    Rabbit Isocite dehydrogenase [NAD] subunit gamma, mitochondrial(IDH3G) ELISA kit
    E04I0426-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Isocite dehydrogenase [NAD] subunit gamma, mitochondrial(IDH3G) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Isocite dehydrogenase [NAD] subunit gamma, mitochondrial(IDH3G) ELISA kit
    E04I0426-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Isocite dehydrogenase [NAD] subunit gamma, mitochondrial(IDH3G) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Isocite dehydrogenase [NAD] subunit gamma, mitochondrial(IDH3G) ELISA kit
    E04I0426-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Isocite dehydrogenase [NAD] subunit gamma, mitochondrial(IDH3G) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Idh3g ORF Vector (Rat) (pORF)
    ORF068487 1.0 ug DNA
    EUR 506
    IDH3G ORF Vector (Human) (pORF)
    ORF005183 1.0 ug DNA
    EUR 95
    IDH3G ORF Vector (Human) (pORF)
    ORF005184 1.0 ug DNA
    EUR 95
    Idh3g ORF Vector (Mouse) (pORF)
    ORF047636 1.0 ug DNA
    EUR 506
    Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
    20-abx214035
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
    20-abx109312
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
    abx145605-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
    abx034520-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
    abx034520-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
    20-abx241882
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
    abx234123-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
    abx431348-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.
    Idh3g sgRNA CRISPR Lentivector set (Mouse)
    K4940501 3 x 1.0 ug
    EUR 339
    Idh3g sgRNA CRISPR Lentivector set (Rat)
    K6801901 3 x 1.0 ug
    EUR 339
    IDH3G sgRNA CRISPR Lentivector set (Human)
    K1015001 3 x 1.0 ug
    EUR 339
    Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody (Biotin)
    20-abx105599
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody (FITC)
    20-abx107017
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody (HRP)
    20-abx108438
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Idh3g sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4940502 1.0 ug DNA
    EUR 154
    Idh3g sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4940503 1.0 ug DNA
    EUR 154
    Idh3g sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4940504 1.0 ug DNA
    EUR 154
    Idh3g sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6801902 1.0 ug DNA
    EUR 154
    Idh3g sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6801903 1.0 ug DNA
    EUR 154
    Idh3g sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6801904 1.0 ug DNA
    EUR 154
    IDH3G sgRNA CRISPR Lentivector (Human) (Target 1)
    K1015002 1.0 ug DNA
    EUR 154
    IDH3G sgRNA CRISPR Lentivector (Human) (Target 2)
    K1015003 1.0 ug DNA
    EUR 154
    IDH3G sgRNA CRISPR Lentivector (Human) (Target 3)
    K1015004 1.0 ug DNA
    EUR 154
    IDH3G Protein Vector (Human) (pPB-C-His)
    PV020729 500 ng
    EUR 329
    IDH3G Protein Vector (Human) (pPB-N-His)
    PV020730 500 ng
    EUR 329
    IDH3G Protein Vector (Human) (pPM-C-HA)
    PV020731 500 ng
    EUR 329
    IDH3G Protein Vector (Human) (pPM-C-His)
    PV020732 500 ng
    EUR 329
    IDH3G Protein Vector (Human) (pPB-C-His)
    PV020733 500 ng
    EUR 329
    IDH3G Protein Vector (Human) (pPB-N-His)
    PV020734 500 ng
    EUR 329
    IDH3G Protein Vector (Human) (pPM-C-HA)
    PV020735 500 ng
    EUR 329
    IDH3G Protein Vector (Human) (pPM-C-His)
    PV020736 500 ng
    EUR 329
    IDH3G Protein Vector (Rat) (pPB-C-His)
    PV273946 500 ng
    EUR 603
    IDH3G Protein Vector (Rat) (pPB-N-His)
    PV273947 500 ng
    EUR 603
    IDH3G Protein Vector (Rat) (pPM-C-HA)
    PV273948 500 ng
    EUR 603
    IDH3G Protein Vector (Rat) (pPM-C-His)
    PV273949 500 ng
    EUR 603
    IDH3G Protein Vector (Mouse) (pPB-C-His)
    PV190542 500 ng
    EUR 603
    IDH3G Protein Vector (Mouse) (pPB-N-His)
    PV190543 500 ng
    EUR 603
    IDH3G Protein Vector (Mouse) (pPM-C-HA)
    PV190544 500 ng
    EUR 603
    IDH3G Protein Vector (Mouse) (pPM-C-His)
    PV190545 500 ng
    EUR 603
    Recombinant Human IDH3G, His-SUMO, E.coli-100ug
    QP6194-ec-100ug 100ug
    EUR 408
    Recombinant Human IDH3G, His-SUMO, E.coli-10ug
    QP6194-ec-10ug 10ug
    EUR 200
    Recombinant Human IDH3G, His-SUMO, E.coli-1mg
    QP6194-ec-1mg 1mg
    EUR 1632
    Recombinant Human IDH3G, His-SUMO, E.coli-200ug
    QP6194-ec-200ug 200ug
    EUR 634
    Recombinant Human IDH3G, His-SUMO, E.coli-500ug
    QP6194-ec-500ug 500ug
    EUR 1060

    IDH3G Rabbit Polyclonal Antibody