PMVK Rabbit Polyclonal Antibody

PMVK Rabbit Polyclonal Antibody

Contact Us Below To Order :

    PMVK Polyclonal Antibody

    28387-50ul 50ul
    EUR 187

    PMVK Polyclonal Antibody

    ABP59958-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human PMVK protein
    • Applications tips:
    Description: A polyclonal antibody for detection of PMVK from Human. This PMVK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PMVK protein

    PMVK Polyclonal Antibody

    ABP59958-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human PMVK protein
    • Applications tips:
    Description: A polyclonal antibody for detection of PMVK from Human. This PMVK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PMVK protein

    PMVK Polyclonal Antibody

    ABP59958-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human PMVK protein
    • Applications tips:
    Description: A polyclonal antibody for detection of PMVK from Human. This PMVK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PMVK protein

    PMVK Polyclonal Antibody

    ES11815-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against PMVK from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    PMVK Polyclonal Antibody

    ES11815-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against PMVK from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    PMVK Rabbit pAb

    A13865-100ul 100 ul
    EUR 308

    PMVK Rabbit pAb

    A13865-200ul 200 ul
    EUR 459

    PMVK Rabbit pAb

    A13865-20ul 20 ul
    EUR 183

    PMVK Rabbit pAb

    A13865-50ul 50 ul
    EUR 223

    PMVK Rabbit pAb

    A13866-100ul 100 ul
    EUR 308

    PMVK Rabbit pAb

    A13866-200ul 200 ul
    EUR 459

    PMVK Rabbit pAb

    A13866-20ul 20 ul
    EUR 183

    PMVK Rabbit pAb

    A13866-50ul 50 ul
    EUR 223

    PMVK Polyclonal Conjugated Antibody

    C28386 100ul
    EUR 397

    PMVK Polyclonal Conjugated Antibody

    C28387 100ul
    EUR 397

    PMVK antibody

    70R-19373 50 ul
    EUR 435
    Description: Rabbit polyclonal PMVK antibody

    PMVK antibody

    70R-13751 100 ug
    EUR 322
    Description: Affinity purified Rabbit polyclonal PMVK antibody

    PMVK antibody

    10R-5327 100 ul
    EUR 691
    Description: Mouse monoclonal PMVK antibody

    PMVK Antibody

    39840-100ul 100ul
    EUR 390

    PMVK Antibody

    1-CSB-PA018258GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against PMVK. Recognizes PMVK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    Human PMVK Antibody

    33163-05111 150 ug
    EUR 261

    anti- PMVK antibody

    FNab06580 100µg
    EUR 548.75
    • Immunogen: phosphomevalonate kinase
    • Uniprot ID: Q15126
    • Gene ID: 10654
    • Research Area: Metabolism
    Description: Antibody raised against PMVK

    Anti-PMVK Antibody

    PA1067 100ug/vial
    EUR 334

    Anti-PMVK antibody

    PAab06580 100 ug
    EUR 386

    Anti-PMVK antibody

    STJ115804 100 µl
    EUR 277
    Description: This gene encodes a peroxisomal enzyme that is a member of the galactokinase, homoserine kinase, mevalonate kinase, and phosphomevalonate kinase (GHMP) family of ATP-dependent enzymes. The encoded protein catalyzes the conversion of mevalonate 5-phosphate to mevalonate 5-diphosphate, which is the fifth step in the mevalonate pathway of isoprenoid biosynthesis. Mutations in this gene are linked to certain types of porokeratosis including disseminated superficial porokeratosis. Alternative splicing results in multiple transcript variants.

    Anti-PMVK antibody

    STJ115805 100 µl
    EUR 277
    Description: This gene encodes a peroxisomal enzyme that is a member of the galactokinase, homoserine kinase, mevalonate kinase, and phosphomevalonate kinase (GHMP) family of ATP-dependent enzymes. The encoded protein catalyzes the conversion of mevalonate 5-phosphate to mevalonate 5-diphosphate, which is the fifth step in the mevalonate pathway of isoprenoid biosynthesis. Mutations in this gene are linked to certain types of porokeratosis including disseminated superficial porokeratosis. Alternative splicing results in multiple transcript variants.

    Anti-PMVK antibody

    STJ192973 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to PMVK

    PMVK siRNA

    20-abx929055
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PMVK siRNA

    20-abx929056
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    anti-PMVK

    YF-PA17142 50 ul
    EUR 363
    Description: Mouse polyclonal to PMVK

    anti-PMVK

    YF-PA17143 50 ug
    EUR 363
    Description: Mouse polyclonal to PMVK

    anti-PMVK

    YF-PA17144 100 ul
    EUR 403
    Description: Rabbit polyclonal to PMVK

    anti-PMVK

    YF-PA17145 100 ug
    EUR 403
    Description: Rabbit polyclonal to PMVK

    Rabbit Phosphomevalonate kinase(PMVK) ELISA kit

    E04P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Phosphomevalonate kinase(PMVK) ELISA kit

    E04P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Phosphomevalonate kinase(PMVK) ELISA kit

    E04P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Phosphomevalonate Kinase (PMVK) Antibody

    abx036227-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Phosphomevalonate Kinase (PMVK) Antibody

    abx236580-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    PMVK cloning plasmid

    CSB-CL018258HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 579
    • Sequence: atggccccgctgggaggcgccccgcggctggtactgctgttcagcggcaagaggaaatccgggaaggacttcgtgaccgaggcgctgcagagcagacttggagctgatgtctgtgctgtcctccggctctctggtccactcaaggaacagtatgctcaggagcatggcttgaactt
    • Show more
    Description: A cloning plasmid for the PMVK gene.

    Anti-PMVK (2B8)

    YF-MA17421 100 ug
    EUR 363
    Description: Mouse monoclonal to PMVK

    Anti-PMVK (2B8)

    YF-MA17422 200 ul
    EUR 363
    Description: Mouse monoclonal to PMVK

    Human PMVK Antibody (Biotin Conjugate)

    33163-05121 150 ug
    EUR 369

    Human PMVK AssayLite Antibody (FITC Conjugate)

    33163-05141 150 ug
    EUR 428

    Human PMVK AssayLite Antibody (RPE Conjugate)

    33163-05151 150 ug
    EUR 428

    Human PMVK AssayLite Antibody (APC Conjugate)

    33163-05161 150 ug
    EUR 428

    Human PMVK AssayLite Antibody (PerCP Conjugate)

    33163-05171 150 ug
    EUR 471

    PMVK protein (His tag)

    80R-1495 100 ug
    EUR 305
    Description: Purified recombinant Human PMVK protein

    PMVK ELISA KIT|Human

    EF001891 96 Tests
    EUR 689

    Mouse PMVK shRNA Plasmid

    20-abx976675
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human PMVK shRNA Plasmid

    20-abx957262
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    PMVK Recombinant Protein (Human)

    RP023917 100 ug Ask for price

    PMVK Recombinant Protein (Mouse)

    RP163097 100 ug Ask for price

    PMVK Recombinant Protein (Mouse)

    RP163100 100 ug Ask for price

    PMVK Recombinant Protein (Rat)

    RP221147 100 ug Ask for price

    Pmvk ORF Vector (Rat) (pORF)

    ORF073717 1.0 ug DNA
    EUR 506

    PMVK ORF Vector (Human) (pORF)

    ORF007973 1.0 ug DNA
    EUR 95

    Pmvk ORF Vector (Mouse) (pORF)

    ORF054367 1.0 ug DNA
    EUR 506

    Pmvk ORF Vector (Mouse) (pORF)

    ORF054368 1.0 ug DNA
    EUR 506

    Rat Phosphomevalonate kinase(PMVK) ELISA kit

    E02P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Phosphomevalonate kinase(PMVK) ELISA kit

    E02P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Phosphomevalonate kinase(PMVK) ELISA kit

    E02P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Phosphomevalonate kinase(PMVK) ELISA kit

    E03P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Phosphomevalonate kinase(PMVK) ELISA kit

    E03P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Phosphomevalonate kinase(PMVK) ELISA kit

    E03P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Phosphomevalonate kinase(PMVK) ELISA kit

    E01P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Phosphomevalonate kinase(PMVK) ELISA kit

    E01P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Phosphomevalonate kinase(PMVK) ELISA kit

    E01P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Phosphomevalonate kinase(PMVK) ELISA kit

    E06P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Phosphomevalonate kinase(PMVK) ELISA kit

    E06P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Phosphomevalonate kinase(PMVK) ELISA kit

    E06P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Phosphomevalonate kinase(PMVK) ELISA kit

    E08P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Phosphomevalonate kinase(PMVK) ELISA kit

    E08P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Phosphomevalonate kinase(PMVK) ELISA kit

    E08P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Phosphomevalonate kinase(PMVK) ELISA kit

    E07P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Phosphomevalonate kinase(PMVK) ELISA kit

    E07P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Phosphomevalonate kinase(PMVK) ELISA kit

    E07P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Phosphomevalonate kinase(PMVK) ELISA kit

    E09P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Phosphomevalonate kinase(PMVK) ELISA kit

    E09P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Phosphomevalonate kinase(PMVK) ELISA kit

    E09P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Bovine Phosphomevalonate kinase, PMVK ELISA KIT

    ELI-19695b 96 Tests
    EUR 928

    Human Phosphomevalonate kinase, PMVK ELISA KIT

    ELI-19696h 96 Tests
    EUR 824

    Mouse Phosphomevalonate kinase, Pmvk ELISA KIT

    ELI-21710m 96 Tests
    EUR 865

    Porcine Phosphomevalonate kinase, PMVK ELISA KIT

    ELI-45542p 96 Tests
    EUR 928

    Human Phosphomevalonate kinase (PMVK) ELISA Kit

    abx382319-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Mouse Phosphomevalonate kinase (PMVK) ELISA Kit

    abx390228-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Pmvk sgRNA CRISPR Lentivector set (Rat)

    K7264101 3 x 1.0 ug
    EUR 339

    Pmvk sgRNA CRISPR Lentivector set (Mouse)

    K3487601 3 x 1.0 ug
    EUR 339

    PMVK sgRNA CRISPR Lentivector set (Human)

    K1675701 3 x 1.0 ug
    EUR 339

    PMVK Phosphomevalonate Kinase Human Recombinant Protein

    PROTQ15126 Regular: 20ug
    EUR 317
    Description: PMVK Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 212 amino acids (1-192 a.a.) and having a molecular mass of 24.1kDa. The PMVK is purified by proprietary chromatographic techniques.

    Guinea pig Phosphomevalonate kinase(PMVK) ELISA kit

    E05P0852-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Phosphomevalonate kinase(PMVK) ELISA kit

    E05P0852-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Phosphomevalonate kinase(PMVK) ELISA kit

    E05P0852-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Recombinant Human Phosphomevalonate Kinase/PMVK (N-6His)

    C248-10ug 10ug
    EUR 202
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 7.5.

    Recombinant Human Phosphomevalonate Kinase/PMVK (N-6His)

    C248-1mg 1mg
    EUR 2283
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 7.5.

    Recombinant Human Phosphomevalonate Kinase/PMVK (N-6His)

    C248-500ug 500ug
    EUR 1613
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 7.5.

    Recombinant Human Phosphomevalonate Kinase/PMVK (N-6His)

    C248-50ug 50ug
    EUR 496
    Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 7.5.

    PMVK Rabbit Polyclonal Antibody