ACTN1 Rabbit Polyclonal Antibody

ACTN1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

ACTN1 Polyclonal Antibody
ES11758-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ACTN1. This antibody is tested and validated for WB, ELISA, WB, ELISA

ACTN1 Rabbit pAb
A1160-100ul	Abclonal	100 ul	EUR 308

ACTN1 Rabbit pAb
A1160-200ul	Abclonal	200 ul	EUR 459

ACTN1 Rabbit pAb
A1160-20ul	Abclonal	20 ul	EUR 183

ACTN1 Rabbit pAb
A1160-50ul	Abclonal	50 ul	EUR 223

ACTN1 antibody
70R-15567	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ACTN1 antibody

ACTN1 Antibody
34156-100ul	SAB	100ul	EUR 252

ACTN1 Antibody
34156-50ul	SAB	50ul	EUR 187

ACTN1 Antibody
32192-100ul	SAB	100ul	EUR 252

ACTN1 antibody
10R-3172	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal ACTN1 antibody

ACTN1 antibody
10R-11454	Fitzgerald	50 ul	EUR 241
Description: Mouse Monoclonal ACTN1 antibody

ACTN1 Antibody
1-CSB-PA001241GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ACTN1 Antibody
1-CSB-PA001241LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:1000-1:5000, IF:1:50-1:200

ACTN1 Antibody
1-CSB-PA070129	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

ACTN1 Antibody
1-CSB-PA080241	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500

ACTN1 Antibody
CSB-PA945352-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ACTN1 Antibody
CSB-PA945352-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ACTN1 Antibody
1-CSB-PA906019	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

ACTN1 Antibody
DF6294	Affbiotech	200ul	EUR 304
Description: ACTN1 Antibody detects endogenous levels of total ACTN1.

ACTN1 antibody
70R-32268	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ACTN1 antibody

ACTN1 Antibody
ABD6294	Lifescience Market	100 ug	EUR 438

ACTN1 Conjugated Antibody
C32192	SAB	100ul	EUR 397

Anti-ACTN1 antibody
STJ192916	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ACTN1

Anti-ACTN1 antibody
STJ22500	St John's Laboratory	100 µl	EUR 277
Description: Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene.

Polyclonal ACTN1 (aa596-609) Antibody (internal region)
APR14794G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ACTN1 (aa596-609) (internal region). This antibody is tested and proven to work in the following applications:

Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human)
4-PAC236Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ACTN1 (Ala28~Asn260) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1)

ACTN1 protein
80R-4307	Fitzgerald	100 ug	EUR 327
Description: Purified Recombinant ACTN1 protein (His tagged)

ACTN1 siRNA
20-abx900153	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ACTN1 siRNA
20-abx906640	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ACTN1 siRNA
20-abx906641	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ACTN1 Antibody, HRP conjugated
1-CSB-PA001241LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ACTN1 Antibody, FITC conjugated
1-CSB-PA001241LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ACTN1 Antibody, Biotin conjugated
1-CSB-PA001241LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), APC
4-PAC236Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ACTN1 (Ala28~Asn260) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with APC.

Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), Biotinylated
4-PAC236Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ACTN1 (Ala28~Asn260) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with Biotin.

Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), Cy3
4-PAC236Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ACTN1 (Ala28~Asn260) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with Cy3.

Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), FITC
4-PAC236Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ACTN1 (Ala28~Asn260) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with FITC.

Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), HRP
4-PAC236Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ACTN1 (Ala28~Asn260) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with HRP.

Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), PE
4-PAC236Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ACTN1 (Ala28~Asn260) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with PE.

ACTN1 Blocking Peptide
DF6294-BP	Affbiotech	1mg	EUR 195

ACTN1 Blocking Peptide
20-abx061810	Abbexa	EUR 258.00 EUR 384.00	1 mg 5 mg
Shipped within 5-10 working days.

ACTN1 cloning plasmid
CSB-CL001241HU-10ug	Cusabio	10ug	EUR 860
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2679 Sequence: atggaccattatgattctcagcaaaccaacgattacatgcagccagaagaggactgggaccgggacctgctcctggacccggcctgggagaagcagcagagaaagacattcacggcatggtgtaactcccacctccggaaggcggggacacagatcgagaacatcgaagaggact Show more
Description: A cloning plasmid for the ACTN1 gene.

Anti-ACTN1 (3F1)
YF-MA20269	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to ACTN1

ACTN1/2/3/4 Antibody
47879-100ul	SAB	100ul	EUR 252

ACTN1/2/3/4 Antibody
45407-100ul	SAB	100ul	EUR 252

ACTN1/2/3/4 Antibody
45407-50ul	SAB	50ul	EUR 187

ACTN1/ACTN2/ACTN3/ACTN4 Antibody
1-CSB-PA000814	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACTN1/ACTN2/ACTN3/ACTN4. Recognizes ACTN1/ACTN2/ACTN3/ACTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

ACTN1/ACTN2/ACTN3/ACTN4 Antibody
CSB-PA096347-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ACTN1/ACTN2/ACTN3/ACTN4. Recognizes ACTN1/ACTN2/ACTN3/ACTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ACTN1/ACTN2/ACTN3/ACTN4 Antibody
CSB-PA096347-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ACTN1/ACTN2/ACTN3/ACTN4. Recognizes ACTN1/ACTN2/ACTN3/ACTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ACTN1/2/3/4 Antibody
DF8633	Affbiotech	200ul	EUR 304
Description: ACTN1/2/3/4 Antibody detects endogenous levels of total ACTN1/2/3/4.

ACTN1/2/3/4 antibody
70R-51785	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal ACTN1/2/3/4 antibody

Actinin Alpha 1 (ACTN1) Antibody
20-abx213695	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Actinin Alpha 1 (ACTN1) Antibody
20-abx110774	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Actinin Alpha 1 (ACTN1) Antibody
20-abx130638	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ACTN1 / 2 / 3 / 4 Antibody
20-abx133831	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Alpha Actinin 1 (ACTN1) Antibody
20-abx133859	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Alpha Actinin 1 (ACTN1) Antibody
abx122374-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

ACTN1 / 2 / 3 / 4 Antibody
20-abx147842	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Actinin Alpha 1 (ACTN1) Antibody
20-abx159318	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Alpha Actinin 1 (ACTN1) Antibody
20-abx141112	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Alpha Actinin 1 (ACTN1) Antibody
20-abx013891	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

ACTN1 / 2 / 3 / 4 Antibody
20-abx013893	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Alpha Actinin 1 (ACTN1) Antibody
abx239833-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Actinin Alpha 1 (ACTN1) Antibody
20-abx330218	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

ACTN1 / ACTN2 / ACTN3 / ACTN4 Antibody
abx332562-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Actinin Alpha 1 (ACTN1) Antibody
20-abx327894	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

ACTN1 / ACTN2 / ACTN3 / ACTN4 Antibody
20-abx328684	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Actinin Alpha 1 (ACTN1) Antibody
abx332763-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Alpha Actinin 1 (ACTN1) Antibody
abx431046-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

ACTN1/2/3/4 Antibody
ABD8633	Lifescience Market	100 ug	EUR 438

Alpha Actinin 1 (ACTN1) Antibody
20-abx001074	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Anti-ACTN1 (aa596-609) antibody
STJ73407	St John's Laboratory	100 µg	EUR 359

Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), APC-Cy7
4-PAC236Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ACTN1 (Ala28~Asn260) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with APC-Cy7.

Human Alpha-Actinin-1 (ACTN1) Antibody
33287-05111	AssayPro	150 ug	EUR 276

ACTN1/2/3/4 Conjugated Antibody
C47879	SAB	100ul	EUR 397

ACTN1/2/3/4 Conjugated Antibody
C45407	SAB	100ul	EUR 397

ACTN1 Rabbit Polyclonal Antibody