LIX1 Rabbit Polyclonal Antibody

LIX1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    LIX1 Polyclonal Antibody
    A59638 100 µg
    EUR 570.55
    Description: Ask the seller for details
    LIX1 Polyclonal Antibody
    ABP59127-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human LIX1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein
    LIX1 Polyclonal Antibody
    ABP59127-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human LIX1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein
    LIX1 Polyclonal Antibody
    ABP59127-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human LIX1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein
    LIX1 Polyclonal Antibody
    ES11804-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against LIX1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    LIX1 Polyclonal Antibody
    ES11804-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against LIX1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    LIX1 Rabbit pAb
    A12809-100ul 100 ul
    EUR 308
    LIX1 Rabbit pAb
    A12809-200ul 200 ul
    EUR 459
    LIX1 Rabbit pAb
    A12809-20ul 20 ul
    EUR 183
    LIX1 Rabbit pAb
    A12809-50ul 50 ul
    EUR 223
    LIX1 Polyclonal Conjugated Antibody
    C27790 100ul
    EUR 397
    LIX1 Antibody
    1-CSB-PA822702LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:10-1:100
    LIX1 antibody
    70R-3596 50 ug
    EUR 467
    Description: Rabbit polyclonal LIX1 antibody
    LIX1 Polyclonal Antibody, Biotin Conjugated
    A59639 100 µg
    EUR 570.55
    Description: The best epigenetics products
    LIX1 Polyclonal Antibody, FITC Conjugated
    A59640 100 µg
    EUR 570.55
    Description: kits suitable for this type of research
    LIX1 Polyclonal Antibody, HRP Conjugated
    A59641 100 µg
    EUR 570.55
    Description: fast delivery possible
    Anti-LIX1 antibody
    STJ114675 100 µl
    EUR 277
    Anti-LIX1 antibody
    STJ192962 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to LIX1
    LIX1 siRNA
    20-abx922646
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    LIX1 siRNA
    20-abx922647
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    anti-LIX1
    YF-PA22607 50 ul
    EUR 363
    Description: Mouse polyclonal to LIX1
    LIX1 Antibody, HRP conjugated
    1-CSB-PA822702LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    LIX1 Antibody, FITC conjugated
    1-CSB-PA822702LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    LIX1 Antibody, Biotin conjugated
    1-CSB-PA822702LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    LIX1 Blocking Peptide
    33R-9181 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LIX1 antibody, catalog no. 70R-3596
    LIX1 cloning plasmid
    CSB-CL822702HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 849
    • Sequence: atggacataaccttggaatctctgagacacatcattgcccaagtcttgcctcacagagatccggctctagtcttcaaagacttgaacgttgtgtcaatgttacaggaattttgggaaagcaagcagcagcagaaggctgcattcccaagtgaaggtgtggtggtctatgagtcact
    • Show more
    Description: A cloning plasmid for the LIX1 gene.
    LIX1 ELISA KIT|Human
    EF005212 96 Tests
    EUR 689
    Mouse LIX1 shRNA Plasmid
    20-abx975718
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human LIX1 shRNA Plasmid
    20-abx966057
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    LIX1 Recombinant Protein (Human)
    RP017857 100 ug Ask for price
    LIX1 Recombinant Protein (Rat)
    RP208283 100 ug Ask for price
    LIX1 Recombinant Protein (Mouse)
    RP147638 100 ug Ask for price
    Protein Limb Expression 1 (LIX1) Antibody
    abx025913-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Protein Limb Expression 1 (LIX1) Antibody
    abx025913-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Protein Limb Expression 1 (LIX1) Antibody
    abx146234-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Protein Limb Expression 1 (LIX1) Antibody
    20-abx318393
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Protein Limb Expression 1 (LIX1) Antibody (HRP)
    20-abx308975
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Protein Limb Expression 1 (LIX1) Antibody (FITC)
    20-abx308976
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Protein Limb Expression 1 (LIX1) Antibody (Biotin)
    20-abx308977
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Recombinant human LIX1-like protein
    P1205 100ug Ask for price
    • Uniprot ID: Q8IVB5
    • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
    Description: Recombinant protein for human LIX1-like protein
    Lix1 ORF Vector (Rat) (pORF)
    ORF069429 1.0 ug DNA
    EUR 506
    LIX1 ORF Vector (Human) (pORF)
    ORF005953 1.0 ug DNA
    EUR 95
    Lix1 ORF Vector (Mouse) (pORF)
    ORF049214 1.0 ug DNA
    EUR 506
    Lix1 sgRNA CRISPR Lentivector set (Mouse)
    K4950401 3 x 1.0 ug
    EUR 339
    Lix1 sgRNA CRISPR Lentivector set (Rat)
    K6580901 3 x 1.0 ug
    EUR 339
    LIX1 sgRNA CRISPR Lentivector set (Human)
    K1219801 3 x 1.0 ug
    EUR 339
    Mouse LIX1- like protein, Lix1l ELISA KIT
    ELI-21048m 96 Tests
    EUR 865
    Human LIX1- like protein, LIX1L ELISA KIT
    ELI-31674h 96 Tests
    EUR 824
    Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4950402 1.0 ug DNA
    EUR 154
    Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4950403 1.0 ug DNA
    EUR 154
    Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4950404 1.0 ug DNA
    EUR 154
    Lix1 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6580902 1.0 ug DNA
    EUR 154
    Lix1 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6580903 1.0 ug DNA
    EUR 154
    Lix1 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6580904 1.0 ug DNA
    EUR 154
    LIX1 sgRNA CRISPR Lentivector (Human) (Target 1)
    K1219802 1.0 ug DNA
    EUR 154
    LIX1 sgRNA CRISPR Lentivector (Human) (Target 2)
    K1219803 1.0 ug DNA
    EUR 154
    LIX1 sgRNA CRISPR Lentivector (Human) (Target 3)
    K1219804 1.0 ug DNA
    EUR 154
    LIX1 Protein Vector (Human) (pPB-C-His)
    PV023809 500 ng
    EUR 329
    LIX1 Protein Vector (Human) (pPB-N-His)
    PV023810 500 ng
    EUR 329
    LIX1 Protein Vector (Human) (pPM-C-HA)
    PV023811 500 ng
    EUR 329
    LIX1 Protein Vector (Human) (pPM-C-His)
    PV023812 500 ng
    EUR 329
    LIX1 Protein Vector (Rat) (pPB-C-His)
    PV277714 500 ng
    EUR 603
    LIX1 Protein Vector (Rat) (pPB-N-His)
    PV277715 500 ng
    EUR 603
    LIX1 Protein Vector (Rat) (pPM-C-HA)
    PV277716 500 ng
    EUR 603
    LIX1 Protein Vector (Rat) (pPM-C-His)
    PV277717 500 ng
    EUR 603
    LIX1 Protein Vector (Mouse) (pPB-C-His)
    PV196854 500 ng
    EUR 603
    LIX1 Protein Vector (Mouse) (pPB-N-His)
    PV196855 500 ng
    EUR 603
    LIX1 Protein Vector (Mouse) (pPM-C-HA)
    PV196856 500 ng
    EUR 603
    LIX1 Protein Vector (Mouse) (pPM-C-His)
    PV196857 500 ng
    EUR 603
    Lix1 3'UTR Luciferase Stable Cell Line
    TU111097 1.0 ml Ask for price
    Lix1 3'UTR GFP Stable Cell Line
    TU161097 1.0 ml Ask for price
    Lix1 3'UTR Luciferase Stable Cell Line
    TU207116 1.0 ml Ask for price
    Lix1 3'UTR GFP Stable Cell Line
    TU257116 1.0 ml Ask for price
    LIX1 3'UTR GFP Stable Cell Line
    TU062512 1.0 ml
    EUR 1521
    LIX1 3'UTR Luciferase Stable Cell Line
    TU012512 1.0 ml
    EUR 1521
    Chicken Protein limb expression 1, LIX1 ELISA KIT
    ELI-08625c 96 Tests
    EUR 928
    Human Protein Limb Expression 1 (LIX1) ELISA Kit
    abx385101-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Mouse Protein Limb Expression 1 (Lix1) ELISA Kit
    abx389765-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    GAPDH Rabbit Polyclonal Antibody
    37985-100ul 100ul
    EUR 252
    GAPDH Rabbit Polyclonal Antibody
    37985-50ul 50ul
    EUR 187
    EFHD1 Rabbit Polyclonal Antibody
    38001-100ul 100ul
    EUR 252
    EFHD1 Rabbit Polyclonal Antibody
    38001-50ul 50ul
    EUR 187
    Alliinase Rabbit Polyclonal Antibody
    38042-100ul 100ul
    EUR 252
    Alliinase Rabbit Polyclonal Antibody
    38042-50ul 50ul
    EUR 187
    ECFP Rabbit Polyclonal Antibody
    38077-100ul 100ul
    EUR 252
    ECFP Rabbit Polyclonal Antibody
    38077-50ul 50ul
    EUR 187
    EYFP Rabbit Polyclonal Antibody
    38078-100ul 100ul
    EUR 252
    EYFP Rabbit Polyclonal Antibody
    38078-50ul 50ul
    EUR 187
    mOrange Rabbit Polyclonal Antibody
    38079-100ul 100ul
    EUR 252
    mOrange Rabbit Polyclonal Antibody
    38079-50ul 50ul
    EUR 187
    mStrawberry Rabbit Polyclonal Antibody
    38083-100ul 100ul
    EUR 252
    mStrawberry Rabbit Polyclonal Antibody
    38083-50ul 50ul
    EUR 187
    AmCyan Rabbit Polyclonal Antibody
    38086-100ul 100ul
    EUR 252
    AmCyan Rabbit Polyclonal Antibody
    38086-50ul 50ul
    EUR 187
    EBFP Rabbit Polyclonal Antibody
    38087-100ul 100ul
    EUR 252
    EBFP Rabbit Polyclonal Antibody
    38087-50ul 50ul
    EUR 187
    Vimentin Rabbit Polyclonal Antibody
    38104-100ul 100ul
    EUR 252
    Vimentin Rabbit Polyclonal Antibody
    38104-50ul 50ul
    EUR 187

    LIX1 Rabbit Polyclonal Antibody