GNB1L Rabbit Polyclonal Antibody

GNB1L Rabbit Polyclonal Antibody

Contact Us Below To Order :

    GNB1L Polyclonal Antibody
    ABP58656-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human GNB1L protein
    • Applications tips:
    Description: A polyclonal antibody for detection of GNB1L from Human, Mouse. This GNB1L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNB1L protein
    GNB1L Polyclonal Antibody
    ABP58656-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human GNB1L protein
    • Applications tips:
    Description: A polyclonal antibody for detection of GNB1L from Human, Mouse. This GNB1L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNB1L protein
    GNB1L Polyclonal Antibody
    ABP58656-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human GNB1L protein
    • Applications tips:
    Description: A polyclonal antibody for detection of GNB1L from Human, Mouse. This GNB1L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNB1L protein
    GNB1L Rabbit pAb
    A7810-100ul 100 ul
    EUR 308
    GNB1L Rabbit pAb
    A7810-200ul 200 ul
    EUR 459
    GNB1L Rabbit pAb
    A7810-20ul 20 ul
    EUR 183
    GNB1L Rabbit pAb
    A7810-50ul 50 ul
    EUR 223
    GNB1L Antibody
    47128-100ul 100ul
    EUR 252
    GNB1L antibody
    70R-1642 100 ug
    EUR 377
    Description: Rabbit polyclonal GNB1L antibody
    GNB1L Antibody
    1-CSB-PA866315ESR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against GNB1L. Recognizes GNB1L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000
    GNB1L Antibody
    1-CSB-PA866315ESR2HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against GNB1L. Recognizes GNB1L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
    GNB1L Conjugated Antibody
    C47128 100ul
    EUR 397
    Anti-GNB1L antibody
    STJ110120 100 µl
    EUR 277
    Description: This gene encodes a G-protein beta-subunit-like polypeptide which is a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 6 WD repeats and is highly expressed in the heart. The gene maps to the region on chromosome 22q11, which is deleted in DiGeorge syndrome, trisomic in derivative 22 syndrome and tetrasomic in cat-eye syndrome. Therefore, this gene may contribute to the etiology of those disorders. Transcripts from this gene share exons with some transcripts from the C22orf29 gene.
    Anti-GNB1L antibody
    STJ193062 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to GNB1L
    GNB1L siRNA
    20-abx918170
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    GNB1L siRNA
    20-abx918171
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    GNB1L Blocking Peptide
    33R-8245 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNB1L antibody, catalog no. 70R-1642
    GNB1L cloning plasmid
    CSB-CL866315HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 984
    • Sequence: atgacggccccctgcccgccgccacctccagacccccagtttgtcctccgaggcacccagtcaccggtgcatgcgctgcacttctgcgaaggagcccaggctcaggggcgcccgctcctcttctcagggtctcagagtggcctggtacacatctggagcctgcagacgcggagagc
    • Show more
    Description: A cloning plasmid for the GNB1L gene.
    pENTR223-GNB1L vector
    PVT11722 2 ug
    EUR 304
    Mouse Gnb1l ELISA KIT
    ELI-09738m 96 Tests
    EUR 865
    Human GNB1L ELISA KIT
    ELI-27253h 96 Tests
    EUR 824
    Human GNB1L shRNA Plasmid
    20-abx960145
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse GNB1L shRNA Plasmid
    20-abx970227
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    GNB1L Recombinant Protein (Human)
    RP013507 100 ug Ask for price
    pECMV-3-FLAG-GNB1L
    PVT13573 2 ug
    EUR 599
    GNB1L Recombinant Protein (Mouse)
    RP138965 100 ug Ask for price
    GNB1L Recombinant Protein (Mouse)
    RP138968 100 ug Ask for price
    GNB1L ORF Vector (Human) (pORF)
    ORF004503 1.0 ug DNA
    EUR 95
    Gnb1l ORF Vector (Mouse) (pORF)
    ORF046323 1.0 ug DNA
    EUR 506
    Gnb1l ORF Vector (Mouse) (pORF)
    ORF046324 1.0 ug DNA
    EUR 506
    GNB1L Western Blot kit (AWBK41328)
    AWBK41328 10 reactions
    EUR 647
    Description:
    • Description of target:
    • Species reactivity:
    • Application:
    • Assay info:
    • Sensitivity:
    GNB1L sgRNA CRISPR Lentivector set (Human)
    K0876001 3 x 1.0 ug
    EUR 339
    Gnb1l sgRNA CRISPR Lentivector set (Mouse)
    K4819201 3 x 1.0 ug
    EUR 339
    GNB1L sgRNA CRISPR Lentivector (Human) (Target 1)
    K0876002 1.0 ug DNA
    EUR 154
    GNB1L sgRNA CRISPR Lentivector (Human) (Target 2)
    K0876003 1.0 ug DNA
    EUR 154
    GNB1L sgRNA CRISPR Lentivector (Human) (Target 3)
    K0876004 1.0 ug DNA
    EUR 154
    Gnb1l sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4819202 1.0 ug DNA
    EUR 154
    Gnb1l sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4819203 1.0 ug DNA
    EUR 154
    Gnb1l sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4819204 1.0 ug DNA
    EUR 154
    GNB1L Protein Vector (Mouse) (pPB-C-His)
    PV185290 500 ng
    EUR 603
    GNB1L Protein Vector (Mouse) (pPB-N-His)
    PV185291 500 ng
    EUR 603
    GNB1L Protein Vector (Mouse) (pPM-C-HA)
    PV185292 500 ng
    EUR 603
    GNB1L Protein Vector (Mouse) (pPM-C-His)
    PV185293 500 ng
    EUR 603
    GNB1L Protein Vector (Mouse) (pPB-C-His)
    PV185294 500 ng
    EUR 603
    GNB1L Protein Vector (Mouse) (pPB-N-His)
    PV185295 500 ng
    EUR 603
    GNB1L Protein Vector (Mouse) (pPM-C-HA)
    PV185296 500 ng
    EUR 603
    GNB1L Protein Vector (Mouse) (pPM-C-His)
    PV185297 500 ng
    EUR 603
    Recombinant Human GNB1L Protein, GST, E.coli-100ug
    QP8085-ec-100ug 100ug
    EUR 571
    Recombinant Human GNB1L Protein, GST, E.coli-10ug
    QP8085-ec-10ug 10ug
    EUR 272
    Recombinant Human GNB1L Protein, GST, E.coli-1mg
    QP8085-ec-1mg 1mg
    EUR 2303
    Recombinant Human GNB1L Protein, GST, E.coli-200ug
    QP8085-ec-200ug 200ug
    EUR 898
    Recombinant Human GNB1L Protein, GST, E.coli-500ug
    QP8085-ec-500ug 500ug
    EUR 1514
    Recombinant Human GNB1L Protein, GST, E.coli-50ug
    QP8085-ec-50ug 50ug
    EUR 362
    GNB1L Protein Vector (Human) (pPB-C-His)
    PV018009 500 ng
    EUR 329
    GNB1L Protein Vector (Human) (pPB-N-His)
    PV018010 500 ng
    EUR 329
    GNB1L Protein Vector (Human) (pPM-C-HA)
    PV018011 500 ng
    EUR 329
    GNB1L Protein Vector (Human) (pPM-C-His)
    PV018012 500 ng
    EUR 329
    Gnb1l 3'UTR Luciferase Stable Cell Line
    TU205217 1.0 ml Ask for price
    Gnb1l 3'UTR GFP Stable Cell Line
    TU158858 1.0 ml Ask for price
    GNB1L 3'UTR Luciferase Stable Cell Line
    TU008984 1.0 ml
    EUR 4617
    Gnb1l 3'UTR Luciferase Stable Cell Line
    TU108858 1.0 ml Ask for price
    GNB1L 3'UTR GFP Stable Cell Line
    TU058984 1.0 ml
    EUR 4617
    Gnb1l 3'UTR GFP Stable Cell Line
    TU255217 1.0 ml Ask for price
    Guanine Nucleotide-Binding Protein Subunit Beta-Like Protein 1 (GNB1L) Antibody
    20-abx006541
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Guanine Nucleotide-Binding Protein Subunit Beta-Like Protein 1 (GNB1L) Antibody
    20-abx321945
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Guanine Nucleotide-Binding Protein Subunit Beta-Like Protein 1 (GNB1L) Antibody
    20-abx322540
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    VEGF Rabbit Polyclonal Antibody
    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    VEGF Rabbit Polyclonal Antibody
    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    CD10 Rabbit Polyclonal Antibody
    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    CD10 Rabbit Polyclonal Antibody
    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NM23A Rabbit Polyclonal Antibody
    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NM23A Rabbit Polyclonal Antibody
    ES8455-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8456-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8456-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8457-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8457-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    HSC70 Rabbit Polyclonal Antibody
    ES8558-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSC70 Rabbit Polyclonal Antibody
    ES8558-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSP40 Rabbit Polyclonal Antibody
    ES8559-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSP40 Rabbit Polyclonal Antibody
    ES8559-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSP90? Rabbit Polyclonal Antibody
    ES8560-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    HSP90? Rabbit Polyclonal Antibody
    ES8560-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    IkB ? Rabbit Polyclonal Antibody
    ES8561-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    IkB ? Rabbit Polyclonal Antibody
    ES8561-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    JAK1 Rabbit Polyclonal Antibody
    ES8562-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    JAK1 Rabbit Polyclonal Antibody
    ES8562-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    JAK2 Rabbit Polyclonal Antibody
    ES8563-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    JAK2 Rabbit Polyclonal Antibody
    ES8563-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    JNK2 Rabbit Polyclonal Antibody
    ES8564-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    JNK2 Rabbit Polyclonal Antibody
    ES8564-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    JNK3 Rabbit Polyclonal Antibody
    ES8565-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    JNK3 Rabbit Polyclonal Antibody
    ES8565-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    MEK2 Rabbit Polyclonal Antibody
    ES8566-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
    MEK2 Rabbit Polyclonal Antibody
    ES8566-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
    MEK3 Rabbit Polyclonal Antibody
    ES8567-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    MEK3 Rabbit Polyclonal Antibody
    ES8567-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    Nrf2 Rabbit Polyclonal Antibody
    ES8568-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    Nrf2 Rabbit Polyclonal Antibody
    ES8568-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG4a Rabbit Polyclonal Antibody
    ES8569-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG4a Rabbit Polyclonal Antibody
    ES8569-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG4b Rabbit Polyclonal Antibody
    ES8570-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG4b Rabbit Polyclonal Antibody
    ES8570-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG4c Rabbit Polyclonal Antibody
    ES8571-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG4c Rabbit Polyclonal Antibody
    ES8571-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    GNB1L Rabbit Polyclonal Antibody