HEY1 Rabbit Polyclonal Antibody

HEY1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    HEY1 Polyclonal Antibody
    ABP58777-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human HEY1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of HEY1 from Human, Mouse. This HEY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HEY1 protein
    HEY1 Polyclonal Antibody
    ABP58777-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human HEY1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of HEY1 from Human, Mouse. This HEY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HEY1 protein
    HEY1 Polyclonal Antibody
    ABP58777-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human HEY1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of HEY1 from Human, Mouse. This HEY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HEY1 protein
    HEY1 Polyclonal Antibody
    A69347 100 ?g
    EUR 628.55
    Description: kits suitable for this type of research
    HEY1 Polyclonal Antibody
    29727-100ul 100ul
    EUR 252
    HEY1 Polyclonal Antibody
    29727-50ul 50ul
    EUR 187
    Rabbit Anti Human Hey1 Polyclonal Antibody
    CPBT-67678RH 25 µg
    EUR 559
    HEY1 Rabbit pAb
    A16110-100ul 100 ul
    EUR 308
    HEY1 Rabbit pAb
    A16110-200ul 200 ul
    EUR 459
    HEY1 Rabbit pAb
    A16110-20ul 20 ul
    EUR 183
    HEY1 Rabbit pAb
    A16110-50ul 50 ul
    EUR 223
    HEY1 Polyclonal Conjugated Antibody
    C29727 100ul
    EUR 397
    HEY1 antibody
    70R-5241 50 ug
    EUR 467
    Description: Rabbit polyclonal HEY1 antibody raised against the middle region of HEY1
    HEY1 antibody
    70R-5242 50 ug
    EUR 467
    Description: Rabbit polyclonal HEY1 antibody raised against the N terminal of HEY1
    Hey1 antibody
    70R-7932 50 ug
    EUR 467
    Description: Affinity purified rabbit polyclonal Hey1 antibody
    HEY1 antibody
    70R-17727 50 ul
    EUR 435
    Description: Rabbit polyclonal HEY1 antibody
    HEY1 Antibody
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500
    HEY1 Antibody
    DF12076 200ul
    EUR 304
    Description: HEY1 antibody detects endogenous levels of HEY1.
    HEY1 Antibody
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
    Polyclonal HEY1 antibody - middle region
    APR00803G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - middle region. This antibody is tested and proven to work in the following applications:
    HEY1 Polyclonal Antibody, HRP Conjugated
    A69348 100 ?g
    EUR 628.55
    Description: fast delivery possible
    HEY1 Polyclonal Antibody, FITC Conjugated
    A69349 100 ?g
    EUR 628.55
    Description: reagents widely cited
    HEY1 Polyclonal Antibody, Biotin Conjugated
    A69350 100 ?g
    EUR 628.55
    Description: Ask the seller for details
    Polyclonal HEY1 Antibody - C-terminal region
    APR00612G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - C-terminal region. This antibody is tested and proven to work in the following applications:
    Polyclonal HEY1 antibody - N-terminal region
    APR00802G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - N-terminal region. This antibody is tested and proven to work in the following applications:
    Polyclonal HEY1 Antibody - C-terminal region
    APR01885G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - C-terminal region. This antibody is tested and proven to work in the following applications:
    anti- HEY1 antibody
    FNab03849 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500-1:5000
    • IP: 1:200-1:2000
    • IHC: 1:20-1:200
    • Immunogen: hairy/enhancer-of-split related with YRPW motif 1
    • Uniprot ID: Q9Y5J3
    • Gene ID: 23462
    • Research Area: Cardiovascular, Metabolism, Developmental biology
    Description: Antibody raised against HEY1
    Anti-HEY1 antibody
    PAab03849 100 ug
    EUR 355
    Anti-HEY1 antibody
    STJ118563 100 µl
    EUR 277
    Anti-HEY1 antibody
    STJ193066 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to HEY1
    HEY1 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PVT17696 2 ug
    EUR 231
    YF-PA17897 50 ul
    EUR 363
    Description: Mouse polyclonal to HEY1
    HEY1 Antibody, HRP conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    HEY1 Antibody, FITC conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    HEY1 Antibody, Biotin conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    HEY1 Blocking Peptide
    33R-3822 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HEY1 antibody, catalog no. 70R-5241
    HEY1 Blocking Peptide
    33R-1335 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHST13 antibody, catalog no. 70R-7171
    Hey1 Blocking Peptide
    33R-9951 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hey1 antibody, catalog no. 70R-7932
    HEY1 Blocking Peptide
    DF12076-BP 1mg
    EUR 195
    HEY1 cloning plasmid
    CSB-CL896909HU-10ug 10ug
    EUR 366
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 915
    • Sequence: atgaagcgagctcaccccgagtacagctcctcggacagcgagctggacgagaccatcgaggtggagaaggagagtgcggacgagaatggaaacttgagttcggctctaggttccatgtccccaactacatcttcccagattttggccagaaaaagacggagaggaataattgagaa
    • Show more
    Description: A cloning plasmid for the HEY1 gene.
    Anti-HEY1 (2F10)
    YF-MA17895 100 ug
    EUR 363
    Description: Mouse monoclonal to HEY1
    Anti-HEY1 (1B9)
    YF-MA17896 100 ug
    EUR 363
    Description: Mouse monoclonal to HEY1
    Anti-HEY1 (3B2)
    YF-MA17897 100 ug
    EUR 363
    Description: Mouse monoclonal to HEY1
    Anti-HEY1 (1E10)
    YF-MA17898 100 ug
    EUR 363
    Description: Mouse monoclonal to HEY1
    Anti-HEY1 (1C9)
    YF-MA17899 100 ug
    EUR 363
    Description: Mouse monoclonal to HEY1
    Anti-HEY1 (4B3)
    YF-MA17900 100 ug
    EUR 363
    Description: Mouse monoclonal to HEY1
    Anti-HEY1 (3G10)
    YF-MA17901 100 ug
    EUR 363
    Description: Mouse monoclonal to HEY1
    Anti-HEY1 (1F11)
    YF-MA17902 100 ug
    EUR 363
    Description: Mouse monoclonal to HEY1
    Anti-HEY1 (3D1)
    YF-MA17903 100 ug
    EUR 363
    Description: Mouse monoclonal to HEY1
    Anti-HEY1 (3E5)
    YF-MA17904 100 ug
    EUR 363
    Description: Mouse monoclonal to HEY1
    Anti-HEY1 (4A3)
    YF-MA17905 100 ug
    EUR 363
    Description: Mouse monoclonal to HEY1
    Anti-HEY1 (3B4)
    YF-MA17906 100 ug
    EUR 363
    Description: Mouse monoclonal to HEY1
    Anti-HEY1 (3B3)
    YF-MA11407 100 ug
    EUR 363
    Description: Mouse monoclonal to HEY1
    Bovine HEY1 ELISA KIT
    ELI-13056b 96 Tests
    EUR 928
    Human HEY1 ELISA KIT
    ELI-20889h 96 Tests
    EUR 824
    Mouse Hey1 ELISA KIT
    ELI-08572m 96 Tests
    EUR 865
    HEY1 ELISA KIT|Human
    EF010111 96 Tests
    EUR 689
    Canine HEY1 ELISA KIT
    ELI-48591d 96 Tests
    EUR 928
    Human HEY1 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    HEY1 Recombinant Protein (Human)
    RP014608 100 ug Ask for price
    HEY1 Recombinant Protein (Rat)
    RP204491 100 ug Ask for price
    HEY1 Recombinant Protein (Mouse)
    RP141374 100 ug Ask for price
    Monoclonal HEY1 Antibody (monoclonal) (M07), Clone: 4B3
    AMM03619G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human HEY1 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 4B3. This antibody is applicable in E
    Monoclonal HEY1 Antibody (monoclonal) (M09), Clone: 1F11
    AMM03620G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human HEY1 (monoclonal) (M09). The antibodies are raised in mouse and are from clone 1F11. This antibody is applicable in WB and IF, E
    HEY1 ORF Vector (Human) (pORF)
    ORF004870 1.0 ug DNA
    EUR 95
    Hey1 ORF Vector (Rat) (pORF)
    ORF068165 1.0 ug DNA
    EUR 506
    Hey1 ORF Vector (Mouse) (pORF)
    ORF047126 1.0 ug DNA
    EUR 506
    pGEX-4T-1-HEY1 Plasmid
    PVTB00542-1a 2 ug
    EUR 356
    HEY1 sgRNA CRISPR Lentivector set (Human)
    K0948201 3 x 1.0 ug
    EUR 339
    Hey1 sgRNA CRISPR Lentivector set (Mouse)
    K4335501 3 x 1.0 ug
    EUR 339
    Hey1 sgRNA CRISPR Lentivector set (Rat)
    K7084601 3 x 1.0 ug
    EUR 339
    HEY1 sgRNA CRISPR Lentivector (Human) (Target 1)
    K0948202 1.0 ug DNA
    EUR 154
    HEY1 sgRNA CRISPR Lentivector (Human) (Target 2)
    K0948203 1.0 ug DNA
    EUR 154
    HEY1 sgRNA CRISPR Lentivector (Human) (Target 3)
    K0948204 1.0 ug DNA
    EUR 154
    Hey1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4335502 1.0 ug DNA
    EUR 154
    Hey1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4335503 1.0 ug DNA
    EUR 154
    Hey1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4335504 1.0 ug DNA
    EUR 154
    Hey1 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K7084602 1.0 ug DNA
    EUR 154
    Hey1 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K7084603 1.0 ug DNA
    EUR 154
    Hey1 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K7084604 1.0 ug DNA
    EUR 154
    HEY1 Protein Vector (Rat) (pPB-C-His)
    PV272658 500 ng
    EUR 603
    HEY1 Protein Vector (Rat) (pPB-N-His)
    PV272659 500 ng
    EUR 603
    HEY1 Protein Vector (Rat) (pPM-C-HA)
    PV272660 500 ng
    EUR 603
    HEY1 Protein Vector (Rat) (pPM-C-His)
    PV272661 500 ng
    EUR 603
    HEY1 Protein Vector (Human) (pPB-C-His)
    PV019477 500 ng
    EUR 329
    HEY1 Protein Vector (Human) (pPB-N-His)
    PV019478 500 ng
    EUR 329
    HEY1 Protein Vector (Human) (pPM-C-HA)
    PV019479 500 ng
    EUR 329
    HEY1 Protein Vector (Human) (pPM-C-His)
    PV019480 500 ng
    EUR 329
    HEY1 Protein Vector (Mouse) (pPB-C-His)
    PV188502 500 ng
    EUR 603
    HEY1 Protein Vector (Mouse) (pPB-N-His)
    PV188503 500 ng
    EUR 603
    HEY1 Protein Vector (Mouse) (pPM-C-HA)
    PV188504 500 ng
    EUR 603
    HEY1 Protein Vector (Mouse) (pPM-C-His)
    PV188505 500 ng
    EUR 603
    Hey1 3'UTR Luciferase Stable Cell Line
    TU205746 1.0 ml Ask for price
    Hey1 3'UTR GFP Stable Cell Line
    TU159476 1.0 ml Ask for price
    HEY1 3'UTR Luciferase Stable Cell Line
    TU009745 1.0 ml
    EUR 1394
    Hey1 3'UTR Luciferase Stable Cell Line
    TU109476 1.0 ml Ask for price
    HEY1 3'UTR GFP Stable Cell Line
    TU059745 1.0 ml
    EUR 1394
    Hey1 3'UTR GFP Stable Cell Line
    TU255746 1.0 ml Ask for price
    HEY1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
    LV626575 1.0 ug DNA
    EUR 514
    HEY1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
    LV626579 1.0 ug DNA
    EUR 514
    HEY1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
    LV626580 1.0 ug DNA
    EUR 514
    VEGF Rabbit Polyclonal Antibody
    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    VEGF Rabbit Polyclonal Antibody
    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    CD10 Rabbit Polyclonal Antibody
    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    CD10 Rabbit Polyclonal Antibody
    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NM23A Rabbit Polyclonal Antibody
    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NM23A Rabbit Polyclonal Antibody
    ES8455-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8456-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8456-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8457-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8457-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HEY1 Rabbit Polyclonal Antibody