HEY1 Rabbit Polyclonal Antibody

HEY1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

HEY1 Polyclonal Antibody
A69347	EpiGentek	100 ?g	EUR 628.55
Description: kits suitable for this type of research

HEY1 Polyclonal Antibody
ABP58777-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human HEY1 protein Applications tips:
Description: A polyclonal antibody for detection of HEY1 from Human, Mouse. This HEY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HEY1 protein

HEY1 Polyclonal Antibody
ABP58777-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human HEY1 protein Applications tips:
Description: A polyclonal antibody for detection of HEY1 from Human, Mouse. This HEY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HEY1 protein

HEY1 Polyclonal Antibody
ABP58777-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human HEY1 protein Applications tips:
Description: A polyclonal antibody for detection of HEY1 from Human, Mouse. This HEY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HEY1 protein

HEY1 Polyclonal Antibody
ES11908-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HEY1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

HEY1 Polyclonal Antibody
ES11908-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HEY1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Rabbit Anti Human Hey1 Polyclonal Antibody
CPBT-67678RH	Creative Diagnostics	25 µg	EUR 559

HEY1 Rabbit pAb
A16110-100ul	Abclonal	100 ul	EUR 308

HEY1 Rabbit pAb
A16110-200ul	Abclonal	200 ul	EUR 459

HEY1 Rabbit pAb
A16110-20ul	Abclonal	20 ul	EUR 183

HEY1 Rabbit pAb
A16110-50ul	Abclonal	50 ul	EUR 223

HEY1 Polyclonal Conjugated Antibody
C29727	SAB	100ul	EUR 397

HEY1 antibody
70R-17727	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal HEY1 antibody

HEY1 Antibody
1-CSB-PA896909LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

HEY1 Antibody
DF12076	Affbiotech	200ul	EUR 304
Description: HEY1 antibody detects endogenous levels of HEY1.

Hey1 antibody
70R-7932	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Hey1 antibody

HEY1 antibody
70R-5241	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal HEY1 antibody raised against the middle region of HEY1

HEY1 antibody
70R-5242	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal HEY1 antibody raised against the N terminal of HEY1

HEY1 Antibody
1-CSB-PA010320GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal HEY1 antibody - middle region
APR00803G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - middle region. This antibody is tested and proven to work in the following applications:

HEY1 Polyclonal Antibody, HRP Conjugated
A69348	EpiGentek	100 ?g	EUR 628.55
Description: fast delivery possible

HEY1 Polyclonal Antibody, FITC Conjugated
A69349	EpiGentek	100 ?g	EUR 628.55
Description: reagents widely cited

HEY1 Polyclonal Antibody, Biotin Conjugated
A69350	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

Polyclonal HEY1 Antibody - C-terminal region
APR00612G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal HEY1 antibody - N-terminal region
APR00802G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal HEY1 Antibody - C-terminal region
APR01885G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - C-terminal region. This antibody is tested and proven to work in the following applications:

anti- HEY1 antibody
FNab03849	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:5000 IP: 1:200-1:2000 IHC: 1:20-1:200 Immunogen: hairy/enhancer-of-split related with YRPW motif 1 Uniprot ID: Q9Y5J3 Gene ID: 23462 Research Area: Cardiovascular, Metabolism, Developmental biology
Description: Antibody raised against HEY1

Anti-HEY1 antibody
PAab03849	Lifescience Market	100 ug	EUR 355

Anti-HEY1 antibody
STJ118563	St John's Laboratory	100 µl	EUR 277

Anti-HEY1 antibody
STJ193066	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to HEY1

HEY1 siRNA
20-abx919305	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-HEY1
PVT17696	Lifescience Market	2 ug	EUR 231

anti-HEY1
YF-PA17897	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to HEY1

HEY1 Antibody, HRP conjugated
1-CSB-PA896909LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HEY1 Antibody, FITC conjugated
1-CSB-PA896909LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HEY1 Antibody, Biotin conjugated
1-CSB-PA896909LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

HEY1 Blocking Peptide
33R-3822	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HEY1 antibody, catalog no. 70R-5241

HEY1 Blocking Peptide
33R-1335	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHST13 antibody, catalog no. 70R-7171

Hey1 Blocking Peptide
33R-9951	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hey1 antibody, catalog no. 70R-7932

HEY1 cloning plasmid
CSB-CL896909HU-10ug	Cusabio	10ug	EUR 366
Formulation: 10 μg plasmid + 200μl Glycerol Length: 915 Sequence: atgaagcgagctcaccccgagtacagctcctcggacagcgagctggacgagaccatcgaggtggagaaggagagtgcggacgagaatggaaacttgagttcggctctaggttccatgtccccaactacatcttcccagattttggccagaaaaagacggagaggaataattgagaa Show more
Description: A cloning plasmid for the HEY1 gene.

HEY1 Blocking Peptide
DF12076-BP	Affbiotech	1mg	EUR 195

Anti-HEY1 (3B3)
YF-MA11407	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (2F10)
YF-MA17895	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (1B9)
YF-MA17896	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (3B2)
YF-MA17897	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (1E10)
YF-MA17898	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (1C9)
YF-MA17899	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (4B3)
YF-MA17900	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (3G10)
YF-MA17901	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (1F11)
YF-MA17902	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (3D1)
YF-MA17903	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (3E5)
YF-MA17904	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (4A3)
YF-MA17905	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (3B4)
YF-MA17906	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HEY1

Bovine HEY1 ELISA KIT
ELI-13056b	Lifescience Market	96 Tests	EUR 928

Human HEY1 ELISA KIT
ELI-20889h	Lifescience Market	96 Tests	EUR 824

Mouse Hey1 ELISA KIT
ELI-08572m	Lifescience Market	96 Tests	EUR 865

HEY1 ELISA KIT|Human
EF010111	Lifescience Market	96 Tests	EUR 689

Human HEY1 shRNA Plasmid
20-abx958284	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Canine HEY1 ELISA KIT
ELI-48591d	Lifescience Market	96 Tests	EUR 928

HEY1 Recombinant Protein (Human)
RP014608	ABM	100 ug	Ask for price

HEY1 Recombinant Protein (Rat)
RP204491	ABM	100 ug	Ask for price

HEY1 Recombinant Protein (Mouse)
RP141374	ABM	100 ug	Ask for price

Monoclonal HEY1 Antibody (monoclonal) (M07), Clone: 4B3
AMM03619G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human HEY1 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 4B3. This antibody is applicable in E

Monoclonal HEY1 Antibody (monoclonal) (M09), Clone: 1F11
AMM03620G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human HEY1 (monoclonal) (M09). The antibodies are raised in mouse and are from clone 1F11. This antibody is applicable in WB and IF, E

Hey1 ORF Vector (Rat) (pORF)
ORF068165	ABM	1.0 ug DNA	EUR 506

HEY1 ORF Vector (Human) (pORF)
ORF004870	ABM	1.0 ug DNA	EUR 95

Hey1 ORF Vector (Mouse) (pORF)
ORF047126	ABM	1.0 ug DNA	EUR 506

pGEX-4T-1-HEY1 Plasmid
PVTB00542-1a	Lifescience Market	2 ug	EUR 356

Hey1 sgRNA CRISPR Lentivector set (Rat)
K7084601	ABM	3 x 1.0 ug	EUR 339

Hey1 sgRNA CRISPR Lentivector set (Mouse)
K4335501	ABM	3 x 1.0 ug	EUR 339

HEY1 sgRNA CRISPR Lentivector set (Human)
K0948201	ABM	3 x 1.0 ug	EUR 339

Hey1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7084602	ABM	1.0 ug DNA	EUR 154

Hey1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7084603	ABM	1.0 ug DNA	EUR 154

Hey1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7084604	ABM	1.0 ug DNA	EUR 154

Hey1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4335502	ABM	1.0 ug DNA	EUR 154

Hey1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4335503	ABM	1.0 ug DNA	EUR 154

Hey1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4335504	ABM	1.0 ug DNA	EUR 154

HEY1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0948202	ABM	1.0 ug DNA	EUR 154

HEY1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0948203	ABM	1.0 ug DNA	EUR 154

HEY1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0948204	ABM	1.0 ug DNA	EUR 154

HEY1 Protein Vector (Rat) (pPB-C-His)
PV272658	ABM	500 ng	EUR 603

HEY1 Protein Vector (Rat) (pPB-N-His)
PV272659	ABM	500 ng	EUR 603

HEY1 Protein Vector (Rat) (pPM-C-HA)
PV272660	ABM	500 ng	EUR 603

HEY1 Protein Vector (Rat) (pPM-C-His)
PV272661	ABM	500 ng	EUR 603

HEY1 Protein Vector (Mouse) (pPB-C-His)
PV188502	ABM	500 ng	EUR 603

HEY1 Protein Vector (Mouse) (pPB-N-His)
PV188503	ABM	500 ng	EUR 603

HEY1 Protein Vector (Mouse) (pPM-C-HA)
PV188504	ABM	500 ng	EUR 603

HEY1 Protein Vector (Mouse) (pPM-C-His)
PV188505	ABM	500 ng	EUR 603

HEY1 Protein Vector (Human) (pPB-C-His)
PV019477	ABM	500 ng	EUR 329

HEY1 Protein Vector (Human) (pPB-N-His)
PV019478	ABM	500 ng	EUR 329

HEY1 Protein Vector (Human) (pPM-C-HA)
PV019479	ABM	500 ng	EUR 329

HEY1 Protein Vector (Human) (pPM-C-His)
PV019480	ABM	500 ng	EUR 329

Hey1 3'UTR Luciferase Stable Cell Line
TU109476	ABM	1.0 ml	Ask for price

Hey1 3'UTR Luciferase Stable Cell Line
TU205746	ABM	1.0 ml	Ask for price

Hey1 3'UTR GFP Stable Cell Line
TU159476	ABM	1.0 ml	Ask for price

Hey1 3'UTR GFP Stable Cell Line
TU255746	ABM	1.0 ml	Ask for price

HEY1 3'UTR GFP Stable Cell Line
TU059745	ABM	1.0 ml	EUR 1394

HEY1 Rabbit Polyclonal Antibody