MCHR1 Rabbit Polyclonal Antibody

MCHR1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

MCHR1 Polyclonal Antibody
ES11507-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MCHR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MCHR1 Polyclonal Antibody
ES11507-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MCHR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MCHR1 Rabbit pAb
A18111-100ul	Abclonal	100 ul	EUR 308

MCHR1 Rabbit pAb
A18111-200ul	Abclonal	200 ul	EUR 459

MCHR1 Rabbit pAb
A18111-20ul	Abclonal	20 ul	EUR 183

MCHR1 Rabbit pAb
A18111-50ul	Abclonal	50 ul	EUR 223

Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit
DLR-MCHR1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Melanin Concentrating Hormone Receptor 1 (MCHR1) in samples from tissue homogenates or other biological fluids.

Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit
DLR-MCHR1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Melanin Concentrating Hormone Receptor 1 (MCHR1) in samples from tissue homogenates or other biological fluids.

Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit
RDR-MCHR1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit
RDR-MCHR1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit
RD-MCHR1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit
RD-MCHR1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Polyclonal MCHR1 Antibody (N-Terminus)
APC00068G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal MCHR1 Antibody (C-Terminus)
APS00038G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal MCHR1 Antibody (C-term)
APR12512G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal MCHR1 Antibody (N-Terminus)
APR12513G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (N-Terminus). This antibody is tested and proven to work in the following applications:

MCHR1 antibody
70R-18438	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal MCHR1 antibody

MCHR1 Antibody
37720-100ul	SAB	100ul	EUR 252

MCHR1 Antibody
1-CSB-PA132314	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

MCHR1 Antibody
1-CSB-PA998557	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

MCHR1 Antibody
DF2819	Affbiotech	200ul	EUR 304
Description: MCHR1 antibody detects endogenous levels of total MCHR1.

MCHR1 Antibody
1-CSB-PA013584GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MCHR1 Antibody
ABD2819	Lifescience Market	100 ug	EUR 438

MCHR1 Conjugated Antibody
C37720	SAB	100ul	EUR 397

anti- MCHR1 antibody
FNab05050	FN Test	100µg	EUR 585
Immunogen: melanin-concentrating hormone receptor 1 Uniprot ID: Q99705 Gene ID: 2847 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against MCHR1

anti- MCHR1 antibody
FNab05051	FN Test	100µg	EUR 505.25
Immunogen: melanin-concentrating hormone receptor 1 Uniprot ID: Q99705 Gene ID: 2847 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against MCHR1

Anti-MCHR1 antibody
PAab05050	Lifescience Market	100 ug	EUR 412

Anti-MCHR1 antibody
PAab05051	Lifescience Market	100 ug	EUR 355

Anti-MCHR1 antibody
STJ11100082	St John's Laboratory	100 µl	EUR 277

Anti-MCHR1 antibody
STJ192665	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MCHR1

Mchr1/ Rat Mchr1 ELISA Kit
ELI-03776r	Lifescience Market	96 Tests	EUR 886

MCHR1 siRNA
20-abx903189	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MCHR1 siRNA
20-abx923721	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MCHR1 siRNA
20-abx923722	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MCHR1 Blocking Peptide
DF2819-BP	Affbiotech	1mg	EUR 195

MCHR1 cloning plasmid
CSB-CL013584HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1269 Sequence: atgtcagtgggagccatgaagaagggagtggggagggcagttgggcttggaggcggcagcggctgccaggctacggaggaagacccccttcccgactgcggggcttgcgctccgggacaaggtggcaggcgctggaggctgccgcagcctgcgtgggtggaggggagctcagctc Show more
Description: A cloning plasmid for the MCHR1 gene.

MCHr1 antagonist 2
HY-100321	MedChemExpress	1mg	EUR 696

MCHr1 antagonist 1
HY-U00353	MedChemExpress	1mg	EUR 1813

Human MCHR1 ELISA Kit
ELA-E1146h	Lifescience Market	96 Tests	EUR 824

MCHR1 ELISA KIT|Human
EF003698	Lifescience Market	96 Tests	EUR 689

Rat MCHR1 shRNA Plasmid
20-abx986797	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human MCHR1 shRNA Plasmid
20-abx951910	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MCHR1 shRNA Plasmid
20-abx980518	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MCHR1 Recombinant Protein (Human)
RP018973	ABM	100 ug	Ask for price

MCHR1 Recombinant Protein (Mouse)
RP149813	ABM	100 ug	Ask for price

MCHR1 Recombinant Protein (Rat)
RP211109	ABM	100 ug	Ask for price

Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit
E04M0388-192T	BlueGene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit
E04M0388-48	BlueGene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit
E04M0388-96	BlueGene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
abx025849-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
abx025849-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
20-abx177519	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
20-abx113654	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
20-abx173523	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
20-abx242224	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
20-abx242225	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
abx235050-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
abx235051-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Mchr1 ORF Vector (Rat) (pORF)
ORF070371	ABM	1.0 ug DNA	EUR 506

MCHR1 ORF Vector (Human) (pORF)
ORF006325	ABM	1.0 ug DNA	EUR 95

Mchr1 ORF Vector (Mouse) (pORF)
ORF049939	ABM	1.0 ug DNA	EUR 506

MCHR1 ELISA Kit (Human) (OKCD08327)
OKCD08327	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The protein encoded by this gene, a member of the G protein-coupled receptor family 1, is an integral plasma membrane protein which binds melanin-concentrating hormone. The encoded protein can inhibit cAMP accumulation and stimulate intracellular calcium flux, and is probably involved in the neuronal regulation of food consumption. Although structurally similar to somatostatin receptors, this protein does not seem to bind somatostatin.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.109ng/mL

MCHR1 ELISA Kit (Mouse) (OKEH05652)
OKEH05652	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Receptor for melanin-concentrating hormone, coupled to both G proteins that inhibit adenylyl cyclase and G proteins that activate phosphoinositide hydrolysis. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.393 ng/mL

MCHR1 ELISA Kit (Rat) (OKEH06219)
OKEH06219	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Receptor for melanin-concentrating hormone, coupled to G proteins that inhibit adenylyl cyclase.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.394 ng/mL

MCHR1 ELISA Kit (Pig) (OKEH07734)
OKEH07734	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

MCHR1 ELISA Kit (Human) (OKEH04640)
OKEH04640	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: The protein encoded by this gene, a member of the G protein-coupled receptor family 1, is an integral plasma membrane protein which binds melanin-concentrating hormone. The encoded protein can inhibit cAMP accumulation and stimulate intracellular calcium flux, and is probably involved in the neuronal regulation of food consumption. Although structurally similar to somatostatin receptors, this protein does not seem to bind somatostatin.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.12 ng/mL

Mchr1 sgRNA CRISPR Lentivector set (Rat)
K6945101	ABM	3 x 1.0 ug	EUR 339

MCHR1 sgRNA CRISPR Lentivector set (Human)
K1279601	ABM	3 x 1.0 ug	EUR 339

Mchr1 sgRNA CRISPR Lentivector set (Mouse)
K3647501	ABM	3 x 1.0 ug	EUR 339

Mchr1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6945102	ABM	1.0 ug DNA	EUR 154

Mchr1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6945103	ABM	1.0 ug DNA	EUR 154

Mchr1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6945104	ABM	1.0 ug DNA	EUR 154

MCHR1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1279602	ABM	1.0 ug DNA	EUR 154

MCHR1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1279603	ABM	1.0 ug DNA	EUR 154

MCHR1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1279604	ABM	1.0 ug DNA	EUR 154

Mchr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3647502	ABM	1.0 ug DNA	EUR 154

Mchr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3647503	ABM	1.0 ug DNA	EUR 154

Mchr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3647504	ABM	1.0 ug DNA	EUR 154

MCHR1 3'UTR Luciferase Stable Cell Line
TU013116	ABM	1.0 ml	EUR 1394

Mchr1 3'UTR Luciferase Stable Cell Line
TU112992	ABM	1.0 ml	Ask for price

Mchr1 3'UTR GFP Stable Cell Line
TU162992	ABM	1.0 ml	Ask for price

Mchr1 3'UTR Luciferase Stable Cell Line
TU212958	ABM	1.0 ml	Ask for price

Mchr1 3'UTR GFP Stable Cell Line
TU262958	ABM	1.0 ml	Ask for price

MCHR1 3'UTR GFP Stable Cell Line
TU063116	ABM	1.0 ml	EUR 1394

MCHR1 Protein Vector (Human) (pPB-C-His)
PV025297	ABM	500 ng	EUR 329

MCHR1 Protein Vector (Human) (pPB-N-His)
PV025298	ABM	500 ng	EUR 329

MCHR1 Protein Vector (Human) (pPM-C-HA)
PV025299	ABM	500 ng	EUR 329

MCHR1 Protein Vector (Rat) (pPB-C-His)
PV281482	ABM	500 ng	EUR 603

MCHR1 Protein Vector (Rat) (pPB-N-His)
PV281483	ABM	500 ng	EUR 603

MCHR1 Protein Vector (Rat) (pPM-C-HA)
PV281484	ABM	500 ng	EUR 603

MCHR1 Protein Vector (Rat) (pPM-C-His)
PV281485	ABM	500 ng	EUR 603

MCHR1 Protein Vector (Mouse) (pPB-C-His)
PV199754	ABM	500 ng	EUR 603

MCHR1 Protein Vector (Mouse) (pPB-N-His)
PV199755	ABM	500 ng	EUR 603

MCHR1 Protein Vector (Mouse) (pPM-C-HA)
PV199756	ABM	500 ng	EUR 603

MCHR1 Protein Vector (Mouse) (pPM-C-His)
PV199757	ABM	500 ng	EUR 603

MCHR1 Protein Vector (Human) (pPM-C-His)
PV025300	ABM	500 ng	EUR 329

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

MCHR1 Rabbit Polyclonal Antibody