MCHR1 Rabbit Polyclonal Antibody
Contact Us Below To Order :
 MCHR1 Polyclonal Antibody |
|
ABP59238-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MCHR1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MCHR1 from Human, Mouse, Rat. This MCHR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCHR1 protein |
MCHR1 Polyclonal Antibody |
|
ABP59238-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MCHR1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MCHR1 from Human, Mouse, Rat. This MCHR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCHR1 protein |
 MCHR1 Rabbit pAb |
|
A18111-100ul |
Abclonal |
100 ul |
EUR 308 |
MCHR1 Rabbit pAb |
|
A18111-200ul |
Abclonal |
200 ul |
EUR 459 |
MCHR1 Rabbit pAb |
|
A18111-20ul |
Abclonal |
20 ul |
EUR 183 |
MCHR1 Rabbit pAb |
|
A18111-50ul |
Abclonal |
50 ul |
EUR 223 |
 ELISA Kit) Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit |
|
DLR-MCHR1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Melanin Concentrating Hormone Receptor 1 (MCHR1) in samples from tissue homogenates or other biological fluids. |
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit |
|
DLR-MCHR1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Melanin Concentrating Hormone Receptor 1 (MCHR1) in samples from tissue homogenates or other biological fluids. |
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit |
|
RD-MCHR1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit |
|
RD-MCHR1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit |
|
RDR-MCHR1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit |
|
RDR-MCHR1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
 MCHR1 Antibody |
|
37720-100ul |
SAB |
100ul |
EUR 252 |
 MCHR1 antibody |
|
70R-18438 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal MCHR1 antibody |
MCHR1 Antibody |
|
1-CSB-PA998557 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
MCHR1 Antibody |
|
DF2819 |
Affbiotech |
200ul |
EUR 304 |
|
Description: MCHR1 antibody detects endogenous levels of total MCHR1. |
MCHR1 Antibody |
|
1-CSB-PA013584GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MCHR1 Antibody |
|
1-CSB-PA132314 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
) Polyclonal MCHR1 Antibody (N-Terminus) |
|
APC00068G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (N-Terminus). This antibody is tested and proven to work in the following applications: |
) Polyclonal MCHR1 Antibody (C-Terminus) |
|
APS00038G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (C-Terminus). This antibody is tested and proven to work in the following applications: |
) Polyclonal MCHR1 Antibody (C-term) |
|
APR12512G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal MCHR1 Antibody (N-Terminus) |
|
APR12513G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (N-Terminus). This antibody is tested and proven to work in the following applications: |
 MCHR1 Conjugated Antibody |
|
C37720 |
SAB |
100ul |
EUR 397 |
 anti- MCHR1 antibody |
|
FNab05050 |
FN Test |
100µg |
EUR 585 |
- Immunogen: melanin-concentrating hormone receptor 1
- Uniprot ID: Q99705
- Gene ID: 2847
- Research Area: Signal Transduction, Metabolism
|
|
Description: Antibody raised against MCHR1 |
anti- MCHR1 antibody |
|
FNab05051 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: melanin-concentrating hormone receptor 1
- Uniprot ID: Q99705
- Gene ID: 2847
- Research Area: Signal Transduction, Metabolism
|
|
Description: Antibody raised against MCHR1 |
 Anti-MCHR1 antibody |
|
STJ192665 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to MCHR1 |
 MCHR1 siRNA |
|
20-abx903189 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MCHR1 siRNA |
|
20-abx923721 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MCHR1 siRNA |
|
20-abx923722 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 MCHR1 cloning plasmid |
|
CSB-CL013584HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1269
- Sequence: atgtcagtgggagccatgaagaagggagtggggagggcagttgggcttggaggcggcagcggctgccaggctacggaggaagacccccttcccgactgcggggcttgcgctccgggacaaggtggcaggcgctggaggctgccgcagcctgcgtgggtggaggggagctcagctc
- Show more
|
|
Description: A cloning plasmid for the MCHR1 gene. |
 MCHR1 Blocking Peptide |
|
DF2819-BP |
Affbiotech |
1mg |
EUR 195 |
 Mouse MCHR1 shRNA Plasmid |
|
20-abx980518 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat MCHR1 shRNA Plasmid |
|
20-abx986797 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human MCHR1 shRNA Plasmid |
|
20-abx951910 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) MCHR1 Recombinant Protein (Human) |
|
RP018973 |
ABM |
100 ug |
Ask for price |
) MCHR1 Recombinant Protein (Rat) |
|
RP211109 |
ABM |
100 ug |
Ask for price |
) MCHR1 Recombinant Protein (Mouse) |
|
RP149813 |
ABM |
100 ug |
Ask for price |
 ELISA kit) Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit |
|
E04M0388-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit |
|
E04M0388-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit |
|
E04M0388-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody) Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
|
20-abx113654 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
|
abx025849-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
|
abx025849-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
|
20-abx173523 |
Abbexa |
|
|
|
|
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
|
20-abx177519 |
Abbexa |
|
|
|
|
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
|
20-abx242224 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
|
20-abx242225 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
|
abx235050-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
|
abx235051-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 (pORF)) MCHR1 ORF Vector (Human) (pORF) |
|
ORF006325 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Mchr1 ORF Vector (Mouse) (pORF) |
|
ORF049939 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Mchr1 ORF Vector (Rat) (pORF) |
|
ORF070371 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKCD08327)) MCHR1 ELISA Kit (Human) (OKCD08327) |
|
OKCD08327 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
|
Description: Description of target: The protein encoded by this gene, a member of the G protein-coupled receptor family 1, is an integral plasma membrane protein which binds melanin-concentrating hormone. The encoded protein can inhibit cAMP accumulation and stimulate intracellular calcium flux, and is probably involved in the neuronal regulation of food consumption. Although structurally similar to somatostatin receptors, this protein does not seem to bind somatostatin.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.109ng/mL |
 (OKEH04640)) MCHR1 ELISA Kit (Human) (OKEH04640) |
|
OKEH04640 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: The protein encoded by this gene, a member of the G protein-coupled receptor family 1, is an integral plasma membrane protein which binds melanin-concentrating hormone. The encoded protein can inhibit cAMP accumulation and stimulate intracellular calcium flux, and is probably involved in the neuronal regulation of food consumption. Although structurally similar to somatostatin receptors, this protein does not seem to bind somatostatin.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.12 ng/mL |
 (OKEH05652)) MCHR1 ELISA Kit (Mouse) (OKEH05652) |
|
OKEH05652 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Receptor for melanin-concentrating hormone, coupled to both G proteins that inhibit adenylyl cyclase and G proteins that activate phosphoinositide hydrolysis. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.393 ng/mL |
 (OKEH06219)) MCHR1 ELISA Kit (Rat) (OKEH06219) |
|
OKEH06219 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Receptor for melanin-concentrating hormone, coupled to G proteins that inhibit adenylyl cyclase.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.394 ng/mL |
 (OKEH07734)) MCHR1 ELISA Kit (Pig) (OKEH07734) |
|
OKEH07734 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
|
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
) MCHR1 sgRNA CRISPR Lentivector set (Human) |
|
K1279601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Mchr1 sgRNA CRISPR Lentivector set (Mouse) |
|
K3647501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Mchr1 sgRNA CRISPR Lentivector set (Rat) |
|
K6945101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) MCHR1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1279602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) MCHR1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1279603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) MCHR1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1279604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Mchr1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3647502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Mchr1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3647503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Mchr1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3647504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Mchr1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6945102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Mchr1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6945103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Mchr1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6945104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) MCHR1 Protein Vector (Rat) (pPB-C-His) |
|
PV281482 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) MCHR1 Protein Vector (Rat) (pPB-N-His) |
|
PV281483 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) MCHR1 Protein Vector (Rat) (pPM-C-HA) |
|
PV281484 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) MCHR1 Protein Vector (Rat) (pPM-C-His) |
|
PV281485 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) MCHR1 Protein Vector (Human) (pPB-C-His) |
|
PV025297 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) MCHR1 Protein Vector (Human) (pPB-N-His) |
|
PV025298 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) MCHR1 Protein Vector (Human) (pPM-C-HA) |
|
PV025299 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) MCHR1 Protein Vector (Human) (pPM-C-His) |
|
PV025300 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) MCHR1 Protein Vector (Mouse) (pPB-C-His) |
|
PV199754 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) MCHR1 Protein Vector (Mouse) (pPB-N-His) |
|
PV199755 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) MCHR1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV199756 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) MCHR1 Protein Vector (Mouse) (pPM-C-His) |
|
PV199757 |
ABM |
500 ng |
EUR 603 |
 Mchr1 3'UTR GFP Stable Cell Line |
|
TU162992 |
ABM |
1.0 ml |
Ask for price |
 Mchr1 3'UTR Luciferase Stable Cell Line |
|
TU212958 |
ABM |
1.0 ml |
Ask for price |
 MCHR1 3'UTR Luciferase Stable Cell Line |
|
TU013116 |
ABM |
1.0 ml |
EUR 1394 |
Mchr1 3'UTR Luciferase Stable Cell Line |
|
TU112992 |
ABM |
1.0 ml |
Ask for price |
 MCHR1 3'UTR GFP Stable Cell Line |
|
TU063116 |
ABM |
1.0 ml |
EUR 1394 |
Mchr1 3'UTR GFP Stable Cell Line |
|
TU262958 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MCHR1 Rabbit Polyclonal Antibody
