MCHR1 Rabbit Polyclonal Antibody

MCHR1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    MCHR1 Polyclonal Antibody

    ES11507-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MCHR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    MCHR1 Polyclonal Antibody

    ES11507-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MCHR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    MCHR1 Rabbit pAb

    A18111-100ul 100 ul
    EUR 308

    MCHR1 Rabbit pAb

    A18111-200ul 200 ul
    EUR 459

    MCHR1 Rabbit pAb

    A18111-20ul 20 ul
    EUR 183

    MCHR1 Rabbit pAb

    A18111-50ul 50 ul
    EUR 223

    Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit

    DLR-MCHR1-Hu-48T 48T
    EUR 517
    • Should the Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Melanin Concentrating Hormone Receptor 1 (MCHR1) in samples from tissue homogenates or other biological fluids.

    Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit

    DLR-MCHR1-Hu-96T 96T
    EUR 673
    • Should the Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Melanin Concentrating Hormone Receptor 1 (MCHR1) in samples from tissue homogenates or other biological fluids.

    Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit

    RDR-MCHR1-Hu-48Tests 48 Tests
    EUR 544

    Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit

    RDR-MCHR1-Hu-96Tests 96 Tests
    EUR 756

    Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit

    RD-MCHR1-Hu-48Tests 48 Tests
    EUR 521

    Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit

    RD-MCHR1-Hu-96Tests 96 Tests
    EUR 723

    MCHR1 antibody

    70R-18438 50 ul
    EUR 435
    Description: Rabbit polyclonal MCHR1 antibody

    MCHR1 Antibody

    37720-100ul 100ul
    EUR 252

    MCHR1 Antibody

    1-CSB-PA132314
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

    MCHR1 Antibody

    1-CSB-PA998557
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

    MCHR1 Antibody

    DF2819 200ul
    EUR 304
    Description: MCHR1 antibody detects endogenous levels of total MCHR1.

    MCHR1 Antibody

    1-CSB-PA013584GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    MCHR1 Antibody

    ABD2819 100 ug
    EUR 438

    Polyclonal MCHR1 Antibody (N-Terminus)

    APC00068G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (N-Terminus). This antibody is tested and proven to work in the following applications:

    Polyclonal MCHR1 Antibody (C-Terminus)

    APS00038G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (C-Terminus). This antibody is tested and proven to work in the following applications:

    Polyclonal MCHR1 Antibody (C-term)

    APR12512G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (C-term). This antibody is tested and proven to work in the following applications:

    Polyclonal MCHR1 Antibody (N-Terminus)

    APR12513G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (N-Terminus). This antibody is tested and proven to work in the following applications:

    MCHR1 Conjugated Antibody

    C37720 100ul
    EUR 397

    anti- MCHR1 antibody

    FNab05050 100µg
    EUR 585
    • Immunogen: melanin-concentrating hormone receptor 1
    • Uniprot ID: Q99705
    • Gene ID: 2847
    • Research Area: Signal Transduction, Metabolism
    Description: Antibody raised against MCHR1

    anti- MCHR1 antibody

    FNab05051 100µg
    EUR 505.25
    • Immunogen: melanin-concentrating hormone receptor 1
    • Uniprot ID: Q99705
    • Gene ID: 2847
    • Research Area: Signal Transduction, Metabolism
    Description: Antibody raised against MCHR1

    Anti-MCHR1 antibody

    PAab05050 100 ug
    EUR 412

    Anti-MCHR1 antibody

    PAab05051 100 ug
    EUR 355

    Anti-MCHR1 antibody

    STJ11100082 100 µl
    EUR 277

    Anti-MCHR1 antibody

    STJ192665 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to MCHR1

    Mchr1/ Rat Mchr1 ELISA Kit

    ELI-03776r 96 Tests
    EUR 886

    MCHR1 siRNA

    20-abx903189
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MCHR1 siRNA

    20-abx923721
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MCHR1 siRNA

    20-abx923722
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MCHR1 Blocking Peptide

    DF2819-BP 1mg
    EUR 195

    MCHR1 cloning plasmid

    CSB-CL013584HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1269
    • Sequence: atgtcagtgggagccatgaagaagggagtggggagggcagttgggcttggaggcggcagcggctgccaggctacggaggaagacccccttcccgactgcggggcttgcgctccgggacaaggtggcaggcgctggaggctgccgcagcctgcgtgggtggaggggagctcagctc
    • Show more
    Description: A cloning plasmid for the MCHR1 gene.

    MCHr1 antagonist 2

    HY-100321 1mg
    EUR 696

    MCHr1 antagonist 1

    HY-U00353 1mg
    EUR 1813

    Human MCHR1 ELISA Kit

    ELA-E1146h 96 Tests
    EUR 824

    MCHR1 ELISA KIT|Human

    EF003698 96 Tests
    EUR 689

    Rat MCHR1 shRNA Plasmid

    20-abx986797
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human MCHR1 shRNA Plasmid

    20-abx951910
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse MCHR1 shRNA Plasmid

    20-abx980518
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    MCHR1 Recombinant Protein (Human)

    RP018973 100 ug Ask for price

    MCHR1 Recombinant Protein (Mouse)

    RP149813 100 ug Ask for price

    MCHR1 Recombinant Protein (Rat)

    RP211109 100 ug Ask for price

    Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit

    E04M0388-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit

    E04M0388-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit

    E04M0388-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

    abx025849-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

    abx025849-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

    20-abx177519
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

    20-abx113654
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

    20-abx173523
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

    20-abx242224
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

    20-abx242225
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

    abx235050-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.

    Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

    abx235051-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Mchr1 ORF Vector (Rat) (pORF)

    ORF070371 1.0 ug DNA
    EUR 506

    MCHR1 ORF Vector (Human) (pORF)

    ORF006325 1.0 ug DNA
    EUR 95

    Mchr1 ORF Vector (Mouse) (pORF)

    ORF049939 1.0 ug DNA
    EUR 506

    MCHR1 ELISA Kit (Human) (OKCD08327)

    OKCD08327 96 Wells
    EUR 975
    Description: Description of target: The protein encoded by this gene, a member of the G protein-coupled receptor family 1, is an integral plasma membrane protein which binds melanin-concentrating hormone. The encoded protein can inhibit cAMP accumulation and stimulate intracellular calcium flux, and is probably involved in the neuronal regulation of food consumption. Although structurally similar to somatostatin receptors, this protein does not seem to bind somatostatin.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.109ng/mL

    MCHR1 ELISA Kit (Mouse) (OKEH05652)

    OKEH05652 96 Wells
    EUR 662
    Description: Description of target: Receptor for melanin-concentrating hormone, coupled to both G proteins that inhibit adenylyl cyclase and G proteins that activate phosphoinositide hydrolysis. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.393 ng/mL

    MCHR1 ELISA Kit (Rat) (OKEH06219)

    OKEH06219 96 Wells
    EUR 662
    Description: Description of target: Receptor for melanin-concentrating hormone, coupled to G proteins that inhibit adenylyl cyclase.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.394 ng/mL

    MCHR1 ELISA Kit (Pig) (OKEH07734)

    OKEH07734 96 Wells
    EUR 1092
    Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

    MCHR1 ELISA Kit (Human) (OKEH04640)

    OKEH04640 96 Wells
    EUR 662
    Description: Description of target: The protein encoded by this gene, a member of the G protein-coupled receptor family 1, is an integral plasma membrane protein which binds melanin-concentrating hormone. The encoded protein can inhibit cAMP accumulation and stimulate intracellular calcium flux, and is probably involved in the neuronal regulation of food consumption. Although structurally similar to somatostatin receptors, this protein does not seem to bind somatostatin.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.12 ng/mL

    Mchr1 sgRNA CRISPR Lentivector set (Rat)

    K6945101 3 x 1.0 ug
    EUR 339

    MCHR1 sgRNA CRISPR Lentivector set (Human)

    K1279601 3 x 1.0 ug
    EUR 339

    Mchr1 sgRNA CRISPR Lentivector set (Mouse)

    K3647501 3 x 1.0 ug
    EUR 339

    Mchr1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6945102 1.0 ug DNA
    EUR 154

    Mchr1 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6945103 1.0 ug DNA
    EUR 154

    Mchr1 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6945104 1.0 ug DNA
    EUR 154

    MCHR1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1279602 1.0 ug DNA
    EUR 154

    MCHR1 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1279603 1.0 ug DNA
    EUR 154

    MCHR1 sgRNA CRISPR Lentivector (Human) (Target 3)

    K1279604 1.0 ug DNA
    EUR 154

    Mchr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3647502 1.0 ug DNA
    EUR 154

    Mchr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3647503 1.0 ug DNA
    EUR 154

    Mchr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3647504 1.0 ug DNA
    EUR 154

    MCHR1 Protein Vector (Human) (pPB-C-His)

    PV025297 500 ng
    EUR 329

    MCHR1 Protein Vector (Human) (pPB-N-His)

    PV025298 500 ng
    EUR 329

    MCHR1 Protein Vector (Human) (pPM-C-HA)

    PV025299 500 ng
    EUR 329

    MCHR1 Protein Vector (Rat) (pPB-C-His)

    PV281482 500 ng
    EUR 603

    MCHR1 Protein Vector (Rat) (pPB-N-His)

    PV281483 500 ng
    EUR 603

    MCHR1 Protein Vector (Rat) (pPM-C-HA)

    PV281484 500 ng
    EUR 603

    MCHR1 Protein Vector (Rat) (pPM-C-His)

    PV281485 500 ng
    EUR 603

    MCHR1 Protein Vector (Mouse) (pPB-C-His)

    PV199754 500 ng
    EUR 603

    MCHR1 Protein Vector (Mouse) (pPB-N-His)

    PV199755 500 ng
    EUR 603

    MCHR1 Protein Vector (Mouse) (pPM-C-HA)

    PV199756 500 ng
    EUR 603

    MCHR1 Protein Vector (Mouse) (pPM-C-His)

    PV199757 500 ng
    EUR 603

    MCHR1 Protein Vector (Human) (pPM-C-His)

    PV025300 500 ng
    EUR 329

    Mchr1 3'UTR Luciferase Stable Cell Line

    TU112992 1.0 ml Ask for price

    Mchr1 3'UTR GFP Stable Cell Line

    TU162992 1.0 ml Ask for price

    Mchr1 3'UTR Luciferase Stable Cell Line

    TU212958 1.0 ml Ask for price

    Mchr1 3'UTR GFP Stable Cell Line

    TU262958 1.0 ml Ask for price

    MCHR1 3'UTR GFP Stable Cell Line

    TU063116 1.0 ml
    EUR 1394

    MCHR1 3'UTR Luciferase Stable Cell Line

    TU013116 1.0 ml
    EUR 1394

    GAPDH Rabbit Polyclonal Antibody

    37985-100ul 100ul
    EUR 252

    MCHR1 Rabbit Polyclonal Antibody