DNMBP Rabbit Polyclonal Antibody

DNMBP Rabbit Polyclonal Antibody

Contact Us Below To Order :

    DNMBP Polyclonal Antibody
    ES11769-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against DNMBP. This antibody is tested and validated for WB, ELISA, WB, ELISA
    DNMBP Polyclonal Antibody
    ES11769-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against DNMBP. This antibody is tested and validated for WB, ELISA, WB, ELISA
    DNMBP antibody
    70R-16902 50 ul
    EUR 435
    Description: Rabbit polyclonal DNMBP antibody
    DNMBP Antibody
    1-CSB-PA007081GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against DNMBP. Recognizes DNMBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
    anti- DNMBP antibody
    FNab02481 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500-1:3000
    • IP: 1:500-1:2000
    • Immunogen: dynamin binding protein
    • Uniprot ID: Q6XZF7
    • Gene ID: 23268
    • Research Area: Neuroscience, Signal Transduction
    Description: Antibody raised against DNMBP
    Anti-DNMBP antibody
    PAab02481 100 ug
    EUR 355
    Anti-DNMBP antibody
    STJ192927 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to DNMBP
    DNMBP siRNA
    20-abx914449
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    DNMBP siRNA
    20-abx914450
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    anti-DNMBP
    YF-PA17814 50 ug
    EUR 363
    Description: Mouse polyclonal to DNMBP
    anti-DNMBP
    YF-PA17815 100 ug
    EUR 403
    Description: Rabbit polyclonal to DNMBP
    anti-DNMBP
    YF-PA27516 100 ul
    EUR 403
    Description: Rabbit polyclonal to DNMBP
    DNMBP cloning plasmid
    CSB-CL757862HU-10ug 10ug
    EUR 801
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2472
    • Sequence: atgacgctcctctcctcccagtcttcatcactggtggccccttctgggtctgtgtctgccgaaaatccagagcagaggatgctggagaagagagccaaggtcatagaagaacttcttcagacagaaagagactacattcgggatctggaaatgtgtattgagcggatcatggtac
    • Show more
    Description: A cloning plasmid for the DNMBP gene.
    Anti-DNMBP (1H2)
    YF-MA17832 100 ug
    EUR 363
    Description: Mouse monoclonal to DNMBP
    Anti-DNMBP (1H2)
    YF-MA17833 200 ul
    EUR 363
    Description: Mouse monoclonal to DNMBP
    Anti-DNMBP (1H2)
    YF-MA17834 200 ul
    EUR 363
    Description: Mouse monoclonal to DNMBP
    Anti-DNMBP (3H7)
    YF-MA17835 100 ug
    EUR 363
    Description: Mouse monoclonal to DNMBP
    Dynamin Binding Protein (DNMBP) Antibody
    20-abx112195
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Dynamin Binding Protein (DNMBP) Antibody
    abx232481-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.
    DNMBP ELISA KIT|Human
    EF009184 96 Tests
    EUR 689
    Mouse DNMBP shRNA Plasmid
    20-abx977608
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human DNMBP shRNA Plasmid
    20-abx958138
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Monoclonal DNMBP Antibody (monoclonal) (M01), Clone: 1H2
    AMM03464G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human DNMBP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1H2. This antibody is applicable in WB
    Monoclonal DNMBP Antibody (monoclonal) (M03), Clone: 3H7
    AMM03465G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human DNMBP (monoclonal) (M03). The antibodies are raised in mouse and are from clone 3H7. This antibody is applicable in WB
    DNMBP ORF Vector (Human) (pORF)
    ORF003221 1.0 ug DNA
    EUR 95
    Dnmbp ORF Vector (Mouse) (pORF)
    ORF043238 1.0 ug DNA
    EUR 1572
    DNMBP sgRNA CRISPR Lentivector set (Human)
    K0622401 3 x 1.0 ug
    EUR 339
    Dnmbp sgRNA CRISPR Lentivector set (Mouse)
    K4704601 3 x 1.0 ug
    EUR 339
    DNMBP-AS1 ORF Vector (Human) (pORF)
    ORF018469 1.0 ug DNA Ask for price
    Human Dynamin- binding protein, DNMBP ELISA KIT
    ELI-26845h 96 Tests
    EUR 824
    Human Dynamin Binding Protein (DNMBP) ELISA Kit
    abx386956-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Mouse Dynamin Binding Protein (DNMBP) ELISA Kit
    abx389117-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Mouse Dynamin- binding protein, Dnmbp ELISA KIT
    ELI-31730m 96 Tests
    EUR 865
    DNMBP sgRNA CRISPR Lentivector (Human) (Target 1)
    K0622402 1.0 ug DNA
    EUR 154
    DNMBP sgRNA CRISPR Lentivector (Human) (Target 2)
    K0622403 1.0 ug DNA
    EUR 154
    DNMBP sgRNA CRISPR Lentivector (Human) (Target 3)
    K0622404 1.0 ug DNA
    EUR 154
    Dnmbp sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4704602 1.0 ug DNA
    EUR 154
    Dnmbp sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4704603 1.0 ug DNA
    EUR 154
    Dnmbp sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4704604 1.0 ug DNA
    EUR 154
    DNMBP Protein Vector (Mouse) (pPB-C-His)
    PV172950 500 ng
    EUR 2660
    DNMBP Protein Vector (Mouse) (pPB-N-His)
    PV172951 500 ng
    EUR 2660
    DNMBP Protein Vector (Mouse) (pPM-C-HA)
    PV172952 500 ng
    EUR 2660
    DNMBP Protein Vector (Mouse) (pPM-C-His)
    PV172953 500 ng
    EUR 2660
    DNMBP Protein Vector (Human) (pPB-C-His)
    PV012881 500 ng
    EUR 329
    DNMBP Protein Vector (Human) (pPB-N-His)
    PV012882 500 ng
    EUR 329
    DNMBP Protein Vector (Human) (pPM-C-HA)
    PV012883 500 ng
    EUR 329
    DNMBP Protein Vector (Human) (pPM-C-His)
    PV012884 500 ng
    EUR 329
    Dnmbp 3'UTR GFP Stable Cell Line
    TU155303 1.0 ml Ask for price
    Dnmbp 3'UTR Luciferase Stable Cell Line
    TU105303 1.0 ml Ask for price
    Dnmbp 3'UTR Luciferase Stable Cell Line
    TU203558 1.0 ml Ask for price
    Dnmbp 3'UTR GFP Stable Cell Line
    TU253558 1.0 ml Ask for price
    DNMBP 3'UTR GFP Stable Cell Line
    TU056218 1.0 ml
    EUR 2333
    DNMBP 3'UTR Luciferase Stable Cell Line
    TU006218 1.0 ml
    EUR 2333
    Dnmbp ELISA Kit| Mouse Dynamin-binding protein ELISA Kit
    EF014747 96 Tests
    EUR 689
    DNMBP-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
    LV723287 1.0 ug DNA Ask for price
    DNMBP-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
    LV723291 1.0 ug DNA Ask for price
    DNMBP-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
    LV723292 1.0 ug DNA Ask for price
    GAPDH Rabbit Polyclonal Antibody
    37985-100ul 100ul
    EUR 252
    GAPDH Rabbit Polyclonal Antibody
    37985-50ul 50ul
    EUR 187
    EFHD1 Rabbit Polyclonal Antibody
    38001-100ul 100ul
    EUR 252
    EFHD1 Rabbit Polyclonal Antibody
    38001-50ul 50ul
    EUR 187
    Alliinase Rabbit Polyclonal Antibody
    38042-100ul 100ul
    EUR 252
    Alliinase Rabbit Polyclonal Antibody
    38042-50ul 50ul
    EUR 187
    ECFP Rabbit Polyclonal Antibody
    38077-100ul 100ul
    EUR 252
    ECFP Rabbit Polyclonal Antibody
    38077-50ul 50ul
    EUR 187
    EYFP Rabbit Polyclonal Antibody
    38078-100ul 100ul
    EUR 252
    EYFP Rabbit Polyclonal Antibody
    38078-50ul 50ul
    EUR 187
    mOrange Rabbit Polyclonal Antibody
    38079-100ul 100ul
    EUR 252
    mOrange Rabbit Polyclonal Antibody
    38079-50ul 50ul
    EUR 187
    mStrawberry Rabbit Polyclonal Antibody
    38083-100ul 100ul
    EUR 252
    mStrawberry Rabbit Polyclonal Antibody
    38083-50ul 50ul
    EUR 187
    AmCyan Rabbit Polyclonal Antibody
    38086-100ul 100ul
    EUR 252
    AmCyan Rabbit Polyclonal Antibody
    38086-50ul 50ul
    EUR 187
    EBFP Rabbit Polyclonal Antibody
    38087-100ul 100ul
    EUR 252
    EBFP Rabbit Polyclonal Antibody
    38087-50ul 50ul
    EUR 187
    Vimentin Rabbit Polyclonal Antibody
    38104-100ul 100ul
    EUR 252
    Vimentin Rabbit Polyclonal Antibody
    38104-50ul 50ul
    EUR 187
    LDHD Rabbit Polyclonal Antibody
    38105-100ul 100ul
    EUR 252
    LDHD Rabbit Polyclonal Antibody
    38105-50ul 50ul
    EUR 187
    GAPDH Rabbit Polyclonal Antibody
    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    Rabbit Hemoglobin Polyclonal Antibody
    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products
    Met Rabbit Polyclonal Antibody
    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    VEGF Rabbit Polyclonal Antibody
    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    CD10 Rabbit Polyclonal Antibody
    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    NM23A Rabbit Polyclonal Antibody
    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    ATM Rabbit Polyclonal Antibody
    ABP57463-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57463-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    DNMBP Rabbit Polyclonal Antibody