DERL2 Rabbit Polyclonal Antibody

DERL2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    Polyclonal DERL2 / Derlin-2 Antibody
    APR15723G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DERL2 / Derlin-2 . This antibody is tested and proven to work in the following applications:
    Anti-DERL2 antibody
    STJ193126 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to DERL2
    DERL2 siRNA
    20-abx914022
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    DERL2 siRNA
    20-abx914023
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Derlin-2 (DERL2) Antibody
    abx030935-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Derlin-2 (DERL2) Antibody
    abx030935-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    DERL2 cloning plasmid
    CSB-CL880924HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 720
    • Sequence: atggcgtaccagagcttgcggctggagtacctgcagatcccaccggtcagccgcgcctacaccactgcctgcgtcctcaccaccgccgccgtgcagttggaattgatcacaccttttcagttgtacttcaatcctgaattaatctttaaacactttcaaatatggagattaatcac
    • Show more
    Description: A cloning plasmid for the DERL2 gene.
    Human DERL2 shRNA Plasmid
    20-abx959450
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse DERL2 shRNA Plasmid
    20-abx980207
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    DERL2 Recombinant Protein (Human)
    RP009169 100 ug Ask for price
    DERL2 Recombinant Protein (Mouse)
    RP128807 100 ug Ask for price
    DERL2 ORF Vector (Human) (pORF)
    ORF003057 1.0 ug DNA
    EUR 95
    Derl2 ORF Vector (Mouse) (pORF)
    ORF042937 1.0 ug DNA
    EUR 506
    Mouse Derlin- 2, Derl2 ELISA KIT
    ELI-26518m 96 Tests
    EUR 865
    Human Derlin- 2, DERL2 ELISA KIT
    ELI-48610h 96 Tests
    EUR 824
    DERL2 sgRNA CRISPR Lentivector set (Human)
    K0585301 3 x 1.0 ug
    EUR 339
    Derl2 sgRNA CRISPR Lentivector set (Mouse)
    K4642101 3 x 1.0 ug
    EUR 339
    Human Derlin 2(DERL2)ELISA Kit
    QY-E04983 96T
    EUR 361
    DERL2 sgRNA CRISPR Lentivector (Human) (Target 1)
    K0585302 1.0 ug DNA
    EUR 154
    DERL2 sgRNA CRISPR Lentivector (Human) (Target 2)
    K0585303 1.0 ug DNA
    EUR 154
    DERL2 sgRNA CRISPR Lentivector (Human) (Target 3)
    K0585304 1.0 ug DNA
    EUR 154
    Derl2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4642102 1.0 ug DNA
    EUR 154
    Derl2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4642103 1.0 ug DNA
    EUR 154
    Derl2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4642104 1.0 ug DNA
    EUR 154
    ELISA kit for Mouse Derlin-2 (DERL2)
    KTE71308-48T 48T
    EUR 332
    • Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER .
    Description: Quantitative sandwich ELISA for measuring Mouse Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Derlin-2 (DERL2)
    KTE71308-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER .
    Description: Quantitative sandwich ELISA for measuring Mouse Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Derlin-2 (DERL2)
    KTE71308-96T 96T
    EUR 539
    • Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER .
    Description: Quantitative sandwich ELISA for measuring Mouse Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Derlin-2 (DERL2)
    KTE62090-48T 48T
    EUR 332
    • Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER.
    Description: Quantitative sandwich ELISA for measuring Human Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Derlin-2 (DERL2)
    KTE62090-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER.
    Description: Quantitative sandwich ELISA for measuring Human Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Derlin-2 (DERL2)
    KTE62090-96T 96T
    EUR 539
    • Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER.
    Description: Quantitative sandwich ELISA for measuring Human Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    DERL2 Protein Vector (Mouse) (pPB-C-His)
    PV171746 500 ng
    EUR 603
    DERL2 Protein Vector (Mouse) (pPB-N-His)
    PV171747 500 ng
    EUR 603
    DERL2 Protein Vector (Mouse) (pPM-C-HA)
    PV171748 500 ng
    EUR 603
    DERL2 Protein Vector (Mouse) (pPM-C-His)
    PV171749 500 ng
    EUR 603
    DERL2 Protein Vector (Human) (pPB-C-His)
    PV012225 500 ng
    EUR 329
    DERL2 Protein Vector (Human) (pPB-N-His)
    PV012226 500 ng
    EUR 329
    DERL2 Protein Vector (Human) (pPM-C-HA)
    PV012227 500 ng
    EUR 329
    DERL2 Protein Vector (Human) (pPM-C-His)
    PV012228 500 ng
    EUR 329
    Derl2 3'UTR GFP Stable Cell Line
    TU155081 1.0 ml Ask for price
    Derl2 3'UTR Luciferase Stable Cell Line
    TU105081 1.0 ml Ask for price
    DERL2 3'UTR GFP Stable Cell Line
    TU055833 1.0 ml
    EUR 2333
    DERL2 3'UTR Luciferase Stable Cell Line
    TU005833 1.0 ml
    EUR 2333
    GAPDH Rabbit Polyclonal Antibody
    37985-100ul 100ul
    EUR 252
    GAPDH Rabbit Polyclonal Antibody
    37985-50ul 50ul
    EUR 187
    EFHD1 Rabbit Polyclonal Antibody
    38001-100ul 100ul
    EUR 252
    EFHD1 Rabbit Polyclonal Antibody
    38001-50ul 50ul
    EUR 187
    Alliinase Rabbit Polyclonal Antibody
    38042-100ul 100ul
    EUR 252
    Alliinase Rabbit Polyclonal Antibody
    38042-50ul 50ul
    EUR 187
    ECFP Rabbit Polyclonal Antibody
    38077-100ul 100ul
    EUR 252
    ECFP Rabbit Polyclonal Antibody
    38077-50ul 50ul
    EUR 187
    EYFP Rabbit Polyclonal Antibody
    38078-100ul 100ul
    EUR 252
    EYFP Rabbit Polyclonal Antibody
    38078-50ul 50ul
    EUR 187
    mOrange Rabbit Polyclonal Antibody
    38079-100ul 100ul
    EUR 252
    mOrange Rabbit Polyclonal Antibody
    38079-50ul 50ul
    EUR 187
    mStrawberry Rabbit Polyclonal Antibody
    38083-100ul 100ul
    EUR 252
    mStrawberry Rabbit Polyclonal Antibody
    38083-50ul 50ul
    EUR 187
    AmCyan Rabbit Polyclonal Antibody
    38086-100ul 100ul
    EUR 252
    AmCyan Rabbit Polyclonal Antibody
    38086-50ul 50ul
    EUR 187
    EBFP Rabbit Polyclonal Antibody
    38087-100ul 100ul
    EUR 252
    EBFP Rabbit Polyclonal Antibody
    38087-50ul 50ul
    EUR 187
    Vimentin Rabbit Polyclonal Antibody
    38104-100ul 100ul
    EUR 252
    Vimentin Rabbit Polyclonal Antibody
    38104-50ul 50ul
    EUR 187
    LDHD Rabbit Polyclonal Antibody
    38105-100ul 100ul
    EUR 252
    LDHD Rabbit Polyclonal Antibody
    38105-50ul 50ul
    EUR 187
    GAPDH Rabbit Polyclonal Antibody
    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    Rabbit Hemoglobin Polyclonal Antibody
    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products
    Met Rabbit Polyclonal Antibody
    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    VEGF Rabbit Polyclonal Antibody
    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    CD10 Rabbit Polyclonal Antibody
    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    NM23A Rabbit Polyclonal Antibody
    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    ATM Rabbit Polyclonal Antibody
    ABP57463-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57463-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57463-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    DERL2 Rabbit Polyclonal Antibody