ATOH7 Rabbit Polyclonal Antibody
Contact Us Below To Order :
 ATOH7 Polyclonal Antibody |
|
ABP57841-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ATOH7 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATOH7 from Human, Mouse. This ATOH7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATOH7 protein |
ATOH7 Polyclonal Antibody |
|
ABP57841-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ATOH7 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATOH7 from Human, Mouse. This ATOH7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATOH7 protein |
ATOH7 Polyclonal Antibody |
|
30875-100ul |
SAB |
100ul |
EUR 252 |
ATOH7 Polyclonal Antibody |
|
30875-50ul |
SAB |
50ul |
EUR 187 |
 ATOH7 Rabbit pAb |
|
A7273-100ul |
Abclonal |
100 ul |
EUR 308 |
ATOH7 Rabbit pAb |
|
A7273-200ul |
Abclonal |
200 ul |
EUR 459 |
ATOH7 Rabbit pAb |
|
A7273-20ul |
Abclonal |
20 ul |
EUR 183 |
ATOH7 Rabbit pAb |
|
A7273-50ul |
Abclonal |
50 ul |
EUR 223 |
 ATOH7 Polyclonal Conjugated Antibody |
|
C30875 |
SAB |
100ul |
EUR 397 |
 ATOH7 Antibody |
|
1-CSB-PA850773ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against ATOH7. Recognizes ATOH7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
ATOH7 Antibody |
|
1-CSB-PA850773ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against ATOH7. Recognizes ATOH7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
 Anti-ATOH7 antibody |
|
STJ29412 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This intronless gene encodes a member of the basic helix-loop-helix family of transcription factors, with similarity to Drosophila atonal gene that controls photoreceptor development. Studies in mice suggest that this gene plays a central role in retinal ganglion cell and optic nerve formation. Mutations in this gene are associated with nonsyndromic congenital retinal nonattachment. |
Anti-ATOH7 antibody |
|
STJ193075 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to ATOH7 |
 ATOH7 siRNA |
|
20-abx908494 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATOH7 siRNA |
|
20-abx908495 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-ATOH7 |
|
YF-PA27681 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to ATOH7 |
 ATOH7 cloning plasmid |
|
CSB-CL850773HU-10ug |
Cusabio |
10ug |
EUR 238 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 459
- Sequence: atgaagtcctgcaagcccagcggcccgccggcgggagcgcgcgttgcacccccgtgcgcgggcggcaccgagtgcgcgggcacgtgcgccggggccgggcggctggagagcgcggcgcgcaggcgcctggcggccaacgcgcgcgagcgccgccgcatgcaggggctcaacactgc
- Show more
|
|
Description: A cloning plasmid for the ATOH7 gene. |
 Mouse ATOH7 shRNA Plasmid |
|
20-abx974337 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human ATOH7 shRNA Plasmid |
|
20-abx966462 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) ATOH7 Recombinant Protein (Human) |
|
RP002254 |
ABM |
100 ug |
Ask for price |
) ATOH7 Recombinant Protein (Rat) |
|
RP191366 |
ABM |
100 ug |
Ask for price |
) ATOH7 Recombinant Protein (Mouse) |
|
RP117833 |
ABM |
100 ug |
Ask for price |
 Antibody) Protein Atonal Homolog 7 (ATOH7) Antibody |
|
20-abx005480 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Protein Atonal Homolog 7 (ATOH7) Antibody |
|
abx031366-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Protein Atonal Homolog 7 (ATOH7) Antibody |
|
abx031366-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Protein Atonal Homolog 7 (ATOH7) Antibody |
|
20-abx320873 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protein Atonal Homolog 7 (ATOH7) Antibody |
|
20-abx320874 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Protein Atonal Homolog 7 (ATOH7) Antibody |
|
abx431967-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Protein Atonal Homolog 7 (ATOH7) Antibody |
|
abx432378-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
 (pORF)) ATOH7 ORF Vector (Human) (pORF) |
|
ORF000752 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Atoh7 ORF Vector (Mouse) (pORF) |
|
ORF039279 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Atoh7 ORF Vector (Rat) (pORF) |
|
ORF063790 |
ABM |
1.0 ug DNA |
EUR 506 |
) ATOH7 sgRNA CRISPR Lentivector set (Human) |
|
K0144301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Atoh7 sgRNA CRISPR Lentivector set (Mouse) |
|
K3931401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Atoh7 sgRNA CRISPR Lentivector set (Rat) |
|
K6083201 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) ATOH7 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0144302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) ATOH7 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0144303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) ATOH7 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0144304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Atoh7 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3931402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Atoh7 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3931403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Atoh7 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3931404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Atoh7 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6083202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Atoh7 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6083203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Atoh7 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6083204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) ATOH7 Protein Vector (Human) (pPB-C-His) |
|
PV003005 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) ATOH7 Protein Vector (Human) (pPB-N-His) |
|
PV003006 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) ATOH7 Protein Vector (Human) (pPM-C-HA) |
|
PV003007 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) ATOH7 Protein Vector (Human) (pPM-C-His) |
|
PV003008 |
ABM |
500 ng |
EUR 329 |
 (pPB-His-MBP)) ATOH7 Protein Vector (Human) (pPB-His-MBP) |
|
PV324866 |
ABM |
500 ng |
EUR 329 |
 (pPB-His-GST)) ATOH7 Protein Vector (Human) (pPB-His-GST) |
|
PV324867 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) ATOH7 Protein Vector (Rat) (pPB-C-His) |
|
PV255158 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) ATOH7 Protein Vector (Rat) (pPB-N-His) |
|
PV255159 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) ATOH7 Protein Vector (Rat) (pPM-C-HA) |
|
PV255160 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) ATOH7 Protein Vector (Rat) (pPM-C-His) |
|
PV255161 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) ATOH7 Protein Vector (Mouse) (pPB-C-His) |
|
PV157114 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) ATOH7 Protein Vector (Mouse) (pPB-N-His) |
|
PV157115 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) ATOH7 Protein Vector (Mouse) (pPM-C-HA) |
|
PV157116 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) ATOH7 Protein Vector (Mouse) (pPM-C-His) |
|
PV157117 |
ABM |
500 ng |
EUR 603 |
 Atoh7 3'UTR Luciferase Stable Cell Line |
|
TU201044 |
ABM |
1.0 ml |
Ask for price |
 Atoh7 3'UTR GFP Stable Cell Line |
|
TU152287 |
ABM |
1.0 ml |
Ask for price |
 ATOH7 3'UTR Luciferase Stable Cell Line |
|
TU001364 |
ABM |
1.0 ml |
EUR 1394 |
Atoh7 3'UTR Luciferase Stable Cell Line |
|
TU102287 |
ABM |
1.0 ml |
Ask for price |
 ATOH7 3'UTR GFP Stable Cell Line |
|
TU051364 |
ABM |
1.0 ml |
EUR 1394 |
Atoh7 3'UTR GFP Stable Cell Line |
|
TU251044 |
ABM |
1.0 ml |
Ask for price |
 Human Protein atonal homolog 7, ATOH7 ELISA KIT |
|
ELI-11455h |
Lifescience Market |
96 Tests |
EUR 824 |
 Chicken Protein atonal homolog 7, ATOH7 ELISA KIT |
|
ELI-24011c |
Lifescience Market |
96 Tests |
EUR 928 |
 Mouse Protein atonal homolog 7, Atoh7 ELISA KIT |
|
ELI-34312m |
Lifescience Market |
96 Tests |
EUR 865 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
ATOH7 Rabbit Polyclonal Antibody
 antibody)
 antibody)