ATOH7 Rabbit Polyclonal Antibody

ATOH7 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    ATOH7 Polyclonal Antibody

    ABP57841-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human ATOH7 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ATOH7 from Human, Mouse. This ATOH7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATOH7 protein

    ATOH7 Polyclonal Antibody

    ABP57841-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human ATOH7 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ATOH7 from Human, Mouse. This ATOH7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATOH7 protein

    ATOH7 Polyclonal Antibody

    30875-100ul 100ul
    EUR 252

    ATOH7 Polyclonal Antibody

    30875-50ul 50ul
    EUR 187

    ATOH7 Rabbit pAb

    A7273-100ul 100 ul
    EUR 308

    ATOH7 Rabbit pAb

    A7273-200ul 200 ul
    EUR 459

    ATOH7 Rabbit pAb

    A7273-20ul 20 ul
    EUR 183

    ATOH7 Rabbit pAb

    A7273-50ul 50 ul
    EUR 223

    ATOH7 Polyclonal Conjugated Antibody

    C30875 100ul
    EUR 397

    ATOH7 Antibody

    1-CSB-PA850773ESR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against ATOH7. Recognizes ATOH7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    ATOH7 Antibody

    1-CSB-PA850773ESR2HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against ATOH7. Recognizes ATOH7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    Anti-ATOH7 antibody

    STJ29412 100 µl
    EUR 277
    Description: This intronless gene encodes a member of the basic helix-loop-helix family of transcription factors, with similarity to Drosophila atonal gene that controls photoreceptor development. Studies in mice suggest that this gene plays a central role in retinal ganglion cell and optic nerve formation. Mutations in this gene are associated with nonsyndromic congenital retinal nonattachment.

    Anti-ATOH7 antibody

    STJ193075 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to ATOH7

    ATOH7 siRNA

    20-abx908494
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ATOH7 siRNA

    20-abx908495
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    anti-ATOH7

    YF-PA27681 100 ug
    EUR 403
    Description: Rabbit polyclonal to ATOH7

    Anti-Atoh7 (zebrafish) antibody

    STJ71272 100 µg
    EUR 260

    Anti-Atoh7 (mouse) antibody

    STJ71273 100 µg
    EUR 260

    ATOH7 cloning plasmid

    CSB-CL850773HU-10ug 10ug
    EUR 238
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 459
    • Sequence: atgaagtcctgcaagcccagcggcccgccggcgggagcgcgcgttgcacccccgtgcgcgggcggcaccgagtgcgcgggcacgtgcgccggggccgggcggctggagagcgcggcgcgcaggcgcctggcggccaacgcgcgcgagcgccgccgcatgcaggggctcaacactgc
    • Show more
    Description: A cloning plasmid for the ATOH7 gene.

    Mouse ATOH7 shRNA Plasmid

    20-abx974337
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human ATOH7 shRNA Plasmid

    20-abx966462
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    ATOH7 Recombinant Protein (Human)

    RP002254 100 ug Ask for price

    ATOH7 Recombinant Protein (Rat)

    RP191366 100 ug Ask for price

    ATOH7 Recombinant Protein (Mouse)

    RP117833 100 ug Ask for price

    Protein Atonal Homolog 7 (ATOH7) Antibody

    20-abx005480
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Protein Atonal Homolog 7 (ATOH7) Antibody

    abx031366-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Protein Atonal Homolog 7 (ATOH7) Antibody

    abx031366-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Protein Atonal Homolog 7 (ATOH7) Antibody

    20-abx320873
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Protein Atonal Homolog 7 (ATOH7) Antibody

    20-abx320874
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Protein Atonal Homolog 7 (ATOH7) Antibody

    abx431967-200ul 200 ul
    EUR 286
    • Shipped within 1-3 working days.

    Protein Atonal Homolog 7 (ATOH7) Antibody

    abx432378-200ul 200 ul
    EUR 286
    • Shipped within 1-3 working days.

    ATOH7 ORF Vector (Human) (pORF)

    ORF000752 1.0 ug DNA
    EUR 95

    Atoh7 ORF Vector (Mouse) (pORF)

    ORF039279 1.0 ug DNA
    EUR 506

    Atoh7 ORF Vector (Rat) (pORF)

    ORF063790 1.0 ug DNA
    EUR 506

    ATOH7 sgRNA CRISPR Lentivector set (Human)

    K0144301 3 x 1.0 ug
    EUR 339

    Atoh7 sgRNA CRISPR Lentivector set (Mouse)

    K3931401 3 x 1.0 ug
    EUR 339

    Atoh7 sgRNA CRISPR Lentivector set (Rat)

    K6083201 3 x 1.0 ug
    EUR 339

    ATOH7 sgRNA CRISPR Lentivector (Human) (Target 1)

    K0144302 1.0 ug DNA
    EUR 154

    ATOH7 sgRNA CRISPR Lentivector (Human) (Target 2)

    K0144303 1.0 ug DNA
    EUR 154

    ATOH7 sgRNA CRISPR Lentivector (Human) (Target 3)

    K0144304 1.0 ug DNA
    EUR 154

    Atoh7 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3931402 1.0 ug DNA
    EUR 154

    Atoh7 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3931403 1.0 ug DNA
    EUR 154

    Atoh7 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3931404 1.0 ug DNA
    EUR 154

    Atoh7 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6083202 1.0 ug DNA
    EUR 154

    Atoh7 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6083203 1.0 ug DNA
    EUR 154

    Atoh7 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6083204 1.0 ug DNA
    EUR 154

    ATOH7 Protein Vector (Human) (pPB-C-His)

    PV003005 500 ng
    EUR 329

    ATOH7 Protein Vector (Human) (pPB-N-His)

    PV003006 500 ng
    EUR 329

    ATOH7 Protein Vector (Human) (pPM-C-HA)

    PV003007 500 ng
    EUR 329

    ATOH7 Protein Vector (Human) (pPM-C-His)

    PV003008 500 ng
    EUR 329

    ATOH7 Protein Vector (Human) (pPB-His-MBP)

    PV324866 500 ng
    EUR 329

    ATOH7 Protein Vector (Human) (pPB-His-GST)

    PV324867 500 ng
    EUR 329

    ATOH7 Protein Vector (Rat) (pPB-C-His)

    PV255158 500 ng
    EUR 603

    ATOH7 Protein Vector (Rat) (pPB-N-His)

    PV255159 500 ng
    EUR 603

    ATOH7 Protein Vector (Rat) (pPM-C-HA)

    PV255160 500 ng
    EUR 603

    ATOH7 Protein Vector (Rat) (pPM-C-His)

    PV255161 500 ng
    EUR 603

    ATOH7 Protein Vector (Mouse) (pPB-C-His)

    PV157114 500 ng
    EUR 603

    ATOH7 Protein Vector (Mouse) (pPB-N-His)

    PV157115 500 ng
    EUR 603

    ATOH7 Protein Vector (Mouse) (pPM-C-HA)

    PV157116 500 ng
    EUR 603

    ATOH7 Protein Vector (Mouse) (pPM-C-His)

    PV157117 500 ng
    EUR 603

    Atoh7 3'UTR Luciferase Stable Cell Line

    TU201044 1.0 ml Ask for price

    Atoh7 3'UTR GFP Stable Cell Line

    TU152287 1.0 ml Ask for price

    ATOH7 3'UTR Luciferase Stable Cell Line

    TU001364 1.0 ml
    EUR 1394

    Atoh7 3'UTR Luciferase Stable Cell Line

    TU102287 1.0 ml Ask for price

    ATOH7 3'UTR GFP Stable Cell Line

    TU051364 1.0 ml
    EUR 1394

    Atoh7 3'UTR GFP Stable Cell Line

    TU251044 1.0 ml Ask for price

    Human Protein atonal homolog 7, ATOH7 ELISA KIT

    ELI-11455h 96 Tests
    EUR 824

    Chicken Protein atonal homolog 7, ATOH7 ELISA KIT

    ELI-24011c 96 Tests
    EUR 928

    Mouse Protein atonal homolog 7, Atoh7 ELISA KIT

    ELI-34312m 96 Tests
    EUR 865

    VEGF Rabbit Polyclonal Antibody

    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    VEGF Rabbit Polyclonal Antibody

    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    IkB ? Rabbit Polyclonal Antibody

    ES8561-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    IkB ? Rabbit Polyclonal Antibody

    ES8561-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JAK1 Rabbit Polyclonal Antibody

    ES8562-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK1 Rabbit Polyclonal Antibody

    ES8562-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK2 Rabbit Polyclonal Antibody

    ES8563-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK2 Rabbit Polyclonal Antibody

    ES8563-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JNK2 Rabbit Polyclonal Antibody

    ES8564-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JNK2 Rabbit Polyclonal Antibody

    ES8564-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JNK3 Rabbit Polyclonal Antibody

    ES8565-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JNK3 Rabbit Polyclonal Antibody

    ES8565-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    MEK2 Rabbit Polyclonal Antibody

    ES8566-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

    MEK2 Rabbit Polyclonal Antibody

    ES8566-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

    MEK3 Rabbit Polyclonal Antibody

    ES8567-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    MEK3 Rabbit Polyclonal Antibody

    ES8567-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Nrf2 Rabbit Polyclonal Antibody

    ES8568-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Nrf2 Rabbit Polyclonal Antibody

    ES8568-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4a Rabbit Polyclonal Antibody

    ES8569-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4a Rabbit Polyclonal Antibody

    ES8569-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4b Rabbit Polyclonal Antibody

    ES8570-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4b Rabbit Polyclonal Antibody

    ES8570-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4c Rabbit Polyclonal Antibody

    ES8571-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4c Rabbit Polyclonal Antibody

    ES8571-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG5 Rabbit Polyclonal Antibody

    ES8572-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG5 Rabbit Polyclonal Antibody

    ES8572-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG7 Rabbit Polyclonal Antibody

    ES8573-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG7 Rabbit Polyclonal Antibody

    ES8573-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8574-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8574-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8575-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8575-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG14L Rabbit Polyclonal Antibody

    ES8576-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG14L Rabbit Polyclonal Antibody

    ES8576-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8578-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8578-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8579-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8579-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    WIPI2 Rabbit Polyclonal Antibody

    ES8580-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    WIPI2 Rabbit Polyclonal Antibody

    ES8580-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Gab1 Rabbit Polyclonal Antibody

    ES8582-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Gab1 Rabbit Polyclonal Antibody

    ES8582-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ERK1 Rabbit Polyclonal Antibody

    ES8583-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ERK1 Rabbit Polyclonal Antibody

    ES8583-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Met Rabbit Polyclonal Antibody

    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    ATOH7 Rabbit Polyclonal Antibody