ABI3 Rabbit Polyclonal Antibody

ABI3 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    ABI3 Polyclonal Antibody

    ES11795-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ABI3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

    ABI3 Antibody

    1-CSB-PA873732LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

    ABI3 Polyclonal Antibody, Biotin Conjugated

    A57951 100 µg
    EUR 570.55
    Description: Ask the seller for details

    ABI3 Polyclonal Antibody, FITC Conjugated

    A57952 100 µg
    EUR 570.55
    Description: The best epigenetics products

    ABI3 Polyclonal Antibody, HRP Conjugated

    A57953 100 µg
    EUR 570.55
    Description: kits suitable for this type of research

    M Abi3 Antibody

    abx034928-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    M Abi3 Antibody

    abx034928-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Anti-ABI3 antibody

    STJ192953 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to ABI3

    ABI3 Protein

    20-abx263309
    • EUR 1609.00
    • EUR 328.00
    • EUR 230.00
    • 100 ug
    • 10 ug
    • 2 µg
    • Shipped within 5-10 working days.

    ABI3 siRNA

    20-abx906411
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ABI3 siRNA

    20-abx906412
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ABI3 Antibody, HRP conjugated

    1-CSB-PA873732LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    ABI3 Antibody, FITC conjugated

    1-CSB-PA873732LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    ABI3 Antibody, Biotin conjugated

    1-CSB-PA873732LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    ABI3 cloning plasmid

    CSB-CL873732HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1101
    • Sequence: atggcggagctacagcagctgcaggagtttgagatccccactggccgggaggctctgaggggcaaccacagtgccctgctgcgggtcgctgactactgcgaggacaactatgtgcaggccacagacaagcggaaggcgctggaggagaccatggccttcactacccaggcactgg
    • Show more
    Description: A cloning plasmid for the ABI3 gene.

    ABI3 protein (His tag)

    80R-2485 100 ug
    EUR 322
    Description: Purified recombinant ABI3 protein (His tag)

    Mouse ABI3 shRNA Plasmid

    20-abx975698
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human ABI3 shRNA Plasmid

    20-abx959616
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    ABI3 Family, Member 3

    PR27188 2 ug
    EUR 191

    ABI3 Recombinant Protein (Human)

    RP000154 100 ug Ask for price

    ABI3 Recombinant Protein (Mouse)

    RP113516 100 ug Ask for price

    ABI3 Recombinant Protein (Mouse)

    RP113519 100 ug Ask for price

    ABI3 Recombinant Protein (Rat)

    RP188693 100 ug Ask for price

    Rabbit ABL gene family member 3(ABI3) ELISA kit

    E04A1158-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit ABL gene family member 3(ABI3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit ABL gene family member 3(ABI3) ELISA kit

    E04A1158-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit ABL gene family member 3(ABI3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit ABL gene family member 3(ABI3) ELISA kit

    E04A1158-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit ABL gene family member 3(ABI3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    ABI Gene Family Member 3 (ABI3) Antibody

    20-abx318426
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Abi3 ORF Vector (Rat) (pORF)

    ORF062899 1.0 ug DNA
    EUR 506

    ABI3 ORF Vector (Human) (pORF)

    ORF000052 1.0 ug DNA
    EUR 95

    Abi3 ORF Vector (Mouse) (pORF)

    ORF037840 1.0 ug DNA
    EUR 506

    Abi3 ORF Vector (Mouse) (pORF)

    ORF037841 1.0 ug DNA
    EUR 506

    ABI3 ELISA Kit (Human) (OKEH08036)

    OKEH08036 96 Wells
    EUR 896
    Description: Description of target: This gene encodes a member of an adaptor protein family. Members of this family encode proteins containing a homeobox homology domain, proline rich region and Src-homology 3 (SH3) domain, and are components of the Abi/WAVE complex which regulates actin polymerization. The encoded protein inhibits ectopic metastasis of tumor cells as well as cell migration. This may be accomplished through interaction with p21-activated kinase. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

    ABI Gene Family Member 3 (ABI3) Antibody (HRP)

    20-abx311285
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    ABI Gene Family Member 3 (ABI3) Antibody (FITC)

    20-abx311286
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    ABI Gene Family Member 3 (ABI3) Antibody (Biotin)

    20-abx311287
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Abi3 sgRNA CRISPR Lentivector set (Rat)

    K6538801 3 x 1.0 ug
    EUR 339

    Abi3 sgRNA CRISPR Lentivector set (Mouse)

    K3436701 3 x 1.0 ug
    EUR 339

    ABI3 sgRNA CRISPR Lentivector set (Human)

    K0023801 3 x 1.0 ug
    EUR 339

    Abi3 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6538802 1.0 ug DNA
    EUR 154

    Abi3 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6538803 1.0 ug DNA
    EUR 154

    Abi3 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6538804 1.0 ug DNA
    EUR 154

    Abi3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3436702 1.0 ug DNA
    EUR 154

    Abi3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3436703 1.0 ug DNA
    EUR 154

    Abi3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3436704 1.0 ug DNA
    EUR 154

    ABI3 sgRNA CRISPR Lentivector (Human) (Target 1)

    K0023802 1.0 ug DNA
    EUR 154

    ABI3 sgRNA CRISPR Lentivector (Human) (Target 2)

    K0023803 1.0 ug DNA
    EUR 154

    ABI3 sgRNA CRISPR Lentivector (Human) (Target 3)

    K0023804 1.0 ug DNA
    EUR 154

    ABI3 Protein Vector (Mouse) (pPB-C-His)

    PV151358 500 ng
    EUR 603

    ABI3 Protein Vector (Mouse) (pPB-N-His)

    PV151359 500 ng
    EUR 603

    ABI3 Protein Vector (Mouse) (pPM-C-HA)

    PV151360 500 ng
    EUR 603

    ABI3 Protein Vector (Mouse) (pPM-C-His)

    PV151361 500 ng
    EUR 603

    ABI3 Protein Vector (Mouse) (pPB-C-His)

    PV151362 500 ng
    EUR 603

    ABI3 Protein Vector (Mouse) (pPB-N-His)

    PV151363 500 ng
    EUR 603

    ABI3 Protein Vector (Mouse) (pPM-C-HA)

    PV151364 500 ng
    EUR 603

    ABI3 Protein Vector (Mouse) (pPM-C-His)

    PV151365 500 ng
    EUR 603

    ABI3 Protein Vector (Rat) (pPB-C-His)

    PV251594 500 ng
    EUR 603

    ABI3 Protein Vector (Rat) (pPB-N-His)

    PV251595 500 ng
    EUR 603

    ABI3 Protein Vector (Rat) (pPM-C-HA)

    PV251596 500 ng
    EUR 603

    ABI3 Protein Vector (Rat) (pPM-C-His)

    PV251597 500 ng
    EUR 603

    ABI3 Protein Vector (Human) (pPB-His-MBP)

    PV318982 500 ng
    EUR 329

    ABI3 Protein Vector (Human) (pPB-His-GST)

    PV318983 500 ng
    EUR 329

    ABI3 Protein Vector (Human) (pPB-C-His)

    PV000205 500 ng
    EUR 329

    ABI3 Protein Vector (Human) (pPB-N-His)

    PV000206 500 ng
    EUR 329

    ABI3 Protein Vector (Human) (pPM-C-HA)

    PV000207 500 ng
    EUR 329

    ABI3 Protein Vector (Human) (pPM-C-His)

    PV000208 500 ng
    EUR 329

    Recombinant Human ABI3 Protein, His, E.coli-100ug

    QP10928-100ug 100ug
    EUR 1261

    Recombinant Human ABI3 Protein, His, E.coli-10ug

    QP10928-10ug 10ug
    EUR 201

    Recombinant Human ABI3 Protein, His, E.coli-2ug

    QP10928-2ug 2ug
    EUR 155

    Abi3 3'UTR Luciferase Stable Cell Line

    TU101197 1.0 ml Ask for price

    Abi3 3'UTR GFP Stable Cell Line

    TU151197 1.0 ml Ask for price

    for Abl Interactor 3 (ABI3)ELISA kit

    SEK183Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

    for Abl Interactor 3 (ABI3)ELISA kit

    SEK183Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

    for Abl Interactor 3 (ABI3)ELISA kit

    SEK183Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

    for Abl Interactor 3 (ABI3)ELISA kit

    SEK183Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

    ELISA Kit for Abl Interactor 3 (ABI3)

    4-SEK183Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Abl Interactor 3 elisa. Alternative names of the recognized antigen: NESH
    • SSH3BP3
    • New molecule including SH3
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Abl Interactor 3 (ABI3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Abi3 3'UTR Luciferase Stable Cell Line

    TU200104 1.0 ml Ask for price

    Abi3 3'UTR GFP Stable Cell Line

    TU250104 1.0 ml Ask for price

    ABI3 3'UTR GFP Stable Cell Line

    TU050110 1.0 ml
    EUR 1394

    ABI3 3'UTR Luciferase Stable Cell Line

    TU000110 1.0 ml
    EUR 1394

    ABI3 ABI Family, Member 3 Human Recombinant Protein

    PROTQ9P2A4 Regular: 10ug
    EUR 317
    Description: ABI3 Human Recombinant produced in E. coli is a single polypeptide chain containing 389 amino acids (1-366) and having a molecular mass of 41.4 kDa.;ABI3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

    GAPDH Rabbit Polyclonal Antibody

    37985-100ul 100ul
    EUR 252

    GAPDH Rabbit Polyclonal Antibody

    37985-50ul 50ul
    EUR 187

    EFHD1 Rabbit Polyclonal Antibody

    38001-100ul 100ul
    EUR 252

    EFHD1 Rabbit Polyclonal Antibody

    38001-50ul 50ul
    EUR 187

    Alliinase Rabbit Polyclonal Antibody

    38042-100ul 100ul
    EUR 252

    Alliinase Rabbit Polyclonal Antibody

    38042-50ul 50ul
    EUR 187

    ECFP Rabbit Polyclonal Antibody

    38077-100ul 100ul
    EUR 252

    ECFP Rabbit Polyclonal Antibody

    38077-50ul 50ul
    EUR 187

    EYFP Rabbit Polyclonal Antibody

    38078-100ul 100ul
    EUR 252

    EYFP Rabbit Polyclonal Antibody

    38078-50ul 50ul
    EUR 187

    mOrange Rabbit Polyclonal Antibody

    38079-100ul 100ul
    EUR 252

    mOrange Rabbit Polyclonal Antibody

    38079-50ul 50ul
    EUR 187

    mStrawberry Rabbit Polyclonal Antibody

    38083-100ul 100ul
    EUR 252

    mStrawberry Rabbit Polyclonal Antibody

    38083-50ul 50ul
    EUR 187

    AmCyan Rabbit Polyclonal Antibody

    38086-100ul 100ul
    EUR 252

    ABI3 Rabbit Polyclonal Antibody