ABI3 Rabbit Polyclonal Antibody

ABI3 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    ABI3 Polyclonal Antibody

    A57950 100 µg
    EUR 570.55
    Description: reagents widely cited

    ABI3 Antibody

    1-CSB-PA873732LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

    ABI3 Polyclonal Antibody, Biotin Conjugated

    A57951 100 µg
    EUR 570.55
    Description: Ask the seller for details

    ABI3 Polyclonal Antibody, FITC Conjugated

    A57952 100 µg
    EUR 570.55
    Description: The best epigenetics products

    ABI3 Polyclonal Antibody, HRP Conjugated

    A57953 100 µg
    EUR 570.55
    Description: kits suitable for this type of research

    M Abi3 Antibody

    abx034928-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    M Abi3 Antibody

    abx034928-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Anti-ABI3 antibody

    STJ192953 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to ABI3

    ABI3 siRNA

    20-abx906411
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ABI3 siRNA

    20-abx906412
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ABI3 Protein

    20-abx263309
    • EUR 1609.00
    • EUR 328.00
    • EUR 230.00
    • 100 ug
    • 10 ug
    • 2 µg
    • Shipped within 5-10 working days.

    ABI3 Antibody, HRP conjugated

    1-CSB-PA873732LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    ABI3 Antibody, FITC conjugated

    1-CSB-PA873732LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    ABI3 Antibody, Biotin conjugated

    1-CSB-PA873732LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    ABI3 cloning plasmid

    CSB-CL873732HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1101
    • Sequence: atggcggagctacagcagctgcaggagtttgagatccccactggccgggaggctctgaggggcaaccacagtgccctgctgcgggtcgctgactactgcgaggacaactatgtgcaggccacagacaagcggaaggcgctggaggagaccatggccttcactacccaggcactgg
    • Show more
    Description: A cloning plasmid for the ABI3 gene.

    Mouse ABI3 shRNA Plasmid

    20-abx975698
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human ABI3 shRNA Plasmid

    20-abx959616
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    ABI3 protein (His tag)

    80R-2485 100 ug
    EUR 322
    Description: Purified recombinant ABI3 protein (His tag)

    ABI3 Family, Member 3

    PR27188 2 ug
    EUR 191

    ABI3 Recombinant Protein (Human)

    RP000154 100 ug Ask for price

    ABI3 Recombinant Protein (Rat)

    RP188693 100 ug Ask for price

    ABI3 Recombinant Protein (Mouse)

    RP113516 100 ug Ask for price

    ABI3 Recombinant Protein (Mouse)

    RP113519 100 ug Ask for price

    Rabbit ABL gene family member 3(ABI3) ELISA kit

    E04A1158-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit ABL gene family member 3(ABI3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit ABL gene family member 3(ABI3) ELISA kit

    E04A1158-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit ABL gene family member 3(ABI3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit ABL gene family member 3(ABI3) ELISA kit

    E04A1158-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit ABL gene family member 3(ABI3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    ABI Gene Family Member 3 (ABI3) Antibody

    20-abx318426
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    ABI3 ORF Vector (Human) (pORF)

    ORF000052 1.0 ug DNA
    EUR 95

    Abi3 ORF Vector (Mouse) (pORF)

    ORF037840 1.0 ug DNA
    EUR 506

    Abi3 ORF Vector (Mouse) (pORF)

    ORF037841 1.0 ug DNA
    EUR 506

    Abi3 ORF Vector (Rat) (pORF)

    ORF062899 1.0 ug DNA
    EUR 506

    ABI3 ELISA Kit (Human) (OKEH08036)

    OKEH08036 96 Wells
    EUR 896
    Description: Description of target: This gene encodes a member of an adaptor protein family. Members of this family encode proteins containing a homeobox homology domain, proline rich region and Src-homology 3 (SH3) domain, and are components of the Abi/WAVE complex which regulates actin polymerization. The encoded protein inhibits ectopic metastasis of tumor cells as well as cell migration. This may be accomplished through interaction with p21-activated kinase. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

    ABI Gene Family Member 3 (ABI3) Antibody (HRP)

    20-abx311285
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    ABI Gene Family Member 3 (ABI3) Antibody (FITC)

    20-abx311286
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    ABI Gene Family Member 3 (ABI3) Antibody (Biotin)

    20-abx311287
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    ABI3 sgRNA CRISPR Lentivector set (Human)

    K0023801 3 x 1.0 ug
    EUR 339

    Abi3 sgRNA CRISPR Lentivector set (Mouse)

    K3436701 3 x 1.0 ug
    EUR 339

    Abi3 sgRNA CRISPR Lentivector set (Rat)

    K6538801 3 x 1.0 ug
    EUR 339

    ABI3 sgRNA CRISPR Lentivector (Human) (Target 1)

    K0023802 1.0 ug DNA
    EUR 154

    ABI3 sgRNA CRISPR Lentivector (Human) (Target 2)

    K0023803 1.0 ug DNA
    EUR 154

    ABI3 sgRNA CRISPR Lentivector (Human) (Target 3)

    K0023804 1.0 ug DNA
    EUR 154

    Abi3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3436702 1.0 ug DNA
    EUR 154

    Abi3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3436703 1.0 ug DNA
    EUR 154

    Abi3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3436704 1.0 ug DNA
    EUR 154

    Abi3 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6538802 1.0 ug DNA
    EUR 154

    Abi3 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6538803 1.0 ug DNA
    EUR 154

    Abi3 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6538804 1.0 ug DNA
    EUR 154

    ABI3 Protein Vector (Human) (pPB-C-His)

    PV000205 500 ng
    EUR 329

    ABI3 Protein Vector (Human) (pPB-N-His)

    PV000206 500 ng
    EUR 329

    ABI3 Protein Vector (Human) (pPM-C-HA)

    PV000207 500 ng
    EUR 329

    ABI3 Protein Vector (Human) (pPM-C-His)

    PV000208 500 ng
    EUR 329

    Recombinant Human ABI3 Protein, His, E.coli-100ug

    QP10928-100ug 100ug
    EUR 1261

    Recombinant Human ABI3 Protein, His, E.coli-10ug

    QP10928-10ug 10ug
    EUR 201

    Recombinant Human ABI3 Protein, His, E.coli-2ug

    QP10928-2ug 2ug
    EUR 155

    ABI3 Protein Vector (Human) (pPB-His-MBP)

    PV318982 500 ng
    EUR 329

    ABI3 Protein Vector (Human) (pPB-His-GST)

    PV318983 500 ng
    EUR 329

    ABI3 Protein Vector (Mouse) (pPB-C-His)

    PV151358 500 ng
    EUR 603

    ABI3 Protein Vector (Mouse) (pPB-N-His)

    PV151359 500 ng
    EUR 603

    ABI3 Protein Vector (Mouse) (pPM-C-HA)

    PV151360 500 ng
    EUR 603

    ABI3 Protein Vector (Mouse) (pPM-C-His)

    PV151361 500 ng
    EUR 603

    ABI3 Protein Vector (Mouse) (pPB-C-His)

    PV151362 500 ng
    EUR 603

    ABI3 Protein Vector (Mouse) (pPB-N-His)

    PV151363 500 ng
    EUR 603

    ABI3 Protein Vector (Mouse) (pPM-C-HA)

    PV151364 500 ng
    EUR 603

    ABI3 Protein Vector (Mouse) (pPM-C-His)

    PV151365 500 ng
    EUR 603

    ABI3 Protein Vector (Rat) (pPB-C-His)

    PV251594 500 ng
    EUR 603

    ABI3 Protein Vector (Rat) (pPB-N-His)

    PV251595 500 ng
    EUR 603

    ABI3 Protein Vector (Rat) (pPM-C-HA)

    PV251596 500 ng
    EUR 603

    ABI3 Protein Vector (Rat) (pPM-C-His)

    PV251597 500 ng
    EUR 603

    Abi3 3'UTR Luciferase Stable Cell Line

    TU200104 1.0 ml Ask for price

    Abi3 3'UTR GFP Stable Cell Line

    TU151197 1.0 ml Ask for price

    for Abl Interactor 3 (ABI3)ELISA kit

    SEK183Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

    for Abl Interactor 3 (ABI3)ELISA kit

    SEK183Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

    for Abl Interactor 3 (ABI3)ELISA kit

    SEK183Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

    for Abl Interactor 3 (ABI3)ELISA kit

    SEK183Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

    ELISA Kit for Abl Interactor 3 (ABI3)

    4-SEK183Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Abl Interactor 3 elisa. Alternative names of the recognized antigen: NESH
    • SSH3BP3
    • New molecule including SH3
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Abl Interactor 3 (ABI3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    ABI3 3'UTR Luciferase Stable Cell Line

    TU000110 1.0 ml
    EUR 1394

    Abi3 3'UTR Luciferase Stable Cell Line

    TU101197 1.0 ml Ask for price

    ABI3 3'UTR GFP Stable Cell Line

    TU050110 1.0 ml
    EUR 1394

    Abi3 3'UTR GFP Stable Cell Line

    TU250104 1.0 ml Ask for price

    ABI3 ABI Family, Member 3 Human Recombinant Protein

    PROTQ9P2A4 Regular: 10ug
    EUR 317
    Description: ABI3 Human Recombinant produced in E. coli is a single polypeptide chain containing 389 amino acids (1-366) and having a molecular mass of 41.4 kDa.;ABI3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

    VEGF Rabbit Polyclonal Antibody

    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    VEGF Rabbit Polyclonal Antibody

    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    IkB ? Rabbit Polyclonal Antibody

    ES8561-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    IkB ? Rabbit Polyclonal Antibody

    ES8561-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JAK1 Rabbit Polyclonal Antibody

    ES8562-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK1 Rabbit Polyclonal Antibody

    ES8562-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK2 Rabbit Polyclonal Antibody

    ES8563-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK2 Rabbit Polyclonal Antibody

    ES8563-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JNK2 Rabbit Polyclonal Antibody

    ES8564-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JNK2 Rabbit Polyclonal Antibody

    ES8564-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JNK3 Rabbit Polyclonal Antibody

    ES8565-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JNK3 Rabbit Polyclonal Antibody

    ES8565-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    MEK2 Rabbit Polyclonal Antibody

    ES8566-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

    MEK2 Rabbit Polyclonal Antibody

    ES8566-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

    MEK3 Rabbit Polyclonal Antibody

    ES8567-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    MEK3 Rabbit Polyclonal Antibody

    ES8567-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Nrf2 Rabbit Polyclonal Antibody

    ES8568-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Nrf2 Rabbit Polyclonal Antibody

    ES8568-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4a Rabbit Polyclonal Antibody

    ES8569-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4a Rabbit Polyclonal Antibody

    ES8569-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4b Rabbit Polyclonal Antibody

    ES8570-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4b Rabbit Polyclonal Antibody

    ES8570-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4c Rabbit Polyclonal Antibody

    ES8571-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4c Rabbit Polyclonal Antibody

    ES8571-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG5 Rabbit Polyclonal Antibody

    ES8572-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG5 Rabbit Polyclonal Antibody

    ES8572-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG7 Rabbit Polyclonal Antibody

    ES8573-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG7 Rabbit Polyclonal Antibody

    ES8573-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8574-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8574-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8575-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8575-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG14L Rabbit Polyclonal Antibody

    ES8576-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG14L Rabbit Polyclonal Antibody

    ES8576-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8578-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8578-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8579-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8579-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    WIPI2 Rabbit Polyclonal Antibody

    ES8580-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    WIPI2 Rabbit Polyclonal Antibody

    ES8580-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Gab1 Rabbit Polyclonal Antibody

    ES8582-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Gab1 Rabbit Polyclonal Antibody

    ES8582-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ERK1 Rabbit Polyclonal Antibody

    ES8583-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ERK1 Rabbit Polyclonal Antibody

    ES8583-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Met Rabbit Polyclonal Antibody

    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    VEGF Rabbit Polyclonal Antibody

    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    CD10 Rabbit Polyclonal Antibody

    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    NM23A Rabbit Polyclonal Antibody

    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    ABI3 Rabbit Polyclonal Antibody