ABI3 Rabbit Polyclonal Antibody

ABI3 Rabbit Polyclonal Antibody

Contact Us Below To Order :

ABI3 Polyclonal Antibody
ES11795-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ABI3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABI3 Antibody
1-CSB-PA873732LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

ABI3 Polyclonal Antibody, Biotin Conjugated
A57951	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

ABI3 Polyclonal Antibody, FITC Conjugated
A57952	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

ABI3 Polyclonal Antibody, HRP Conjugated
A57953	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

M Abi3 Antibody
abx034928-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

M Abi3 Antibody
abx034928-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Anti-ABI3 antibody
STJ192953	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ABI3

ABI3 Protein
20-abx263309	Abbexa	EUR 1609.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

ABI3 siRNA
20-abx906411	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ABI3 siRNA
20-abx906412	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ABI3 Antibody, HRP conjugated
1-CSB-PA873732LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ABI3 Antibody, FITC conjugated
1-CSB-PA873732LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ABI3 Antibody, Biotin conjugated
1-CSB-PA873732LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ABI3 cloning plasmid
CSB-CL873732HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1101 Sequence: atggcggagctacagcagctgcaggagtttgagatccccactggccgggaggctctgaggggcaaccacagtgccctgctgcgggtcgctgactactgcgaggacaactatgtgcaggccacagacaagcggaaggcgctggaggagaccatggccttcactacccaggcactgg Show more
Description: A cloning plasmid for the ABI3 gene.

ABI3 protein (His tag)
80R-2485	Fitzgerald	100 ug	EUR 322
Description: Purified recombinant ABI3 protein (His tag)

Mouse ABI3 shRNA Plasmid
20-abx975698	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ABI3 shRNA Plasmid
20-abx959616	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ABI3 Family, Member 3
PR27188	Neuromics	2 ug	EUR 191

ABI3 Recombinant Protein (Human)
RP000154	ABM	100 ug	Ask for price

ABI3 Recombinant Protein (Mouse)
RP113516	ABM	100 ug	Ask for price

ABI3 Recombinant Protein (Mouse)
RP113519	ABM	100 ug	Ask for price

ABI3 Recombinant Protein (Rat)
RP188693	ABM	100 ug	Ask for price

Rabbit ABL gene family member 3(ABI3) ELISA kit
E04A1158-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ABL gene family member 3(ABI3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ABL gene family member 3(ABI3) ELISA kit
E04A1158-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ABL gene family member 3(ABI3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ABL gene family member 3(ABI3) ELISA kit
E04A1158-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ABL gene family member 3(ABI3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ABI Gene Family Member 3 (ABI3) Antibody
20-abx318426	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Abi3 ORF Vector (Rat) (pORF)
ORF062899	ABM	1.0 ug DNA	EUR 506

ABI3 ORF Vector (Human) (pORF)
ORF000052	ABM	1.0 ug DNA	EUR 95

Abi3 ORF Vector (Mouse) (pORF)
ORF037840	ABM	1.0 ug DNA	EUR 506

Abi3 ORF Vector (Mouse) (pORF)
ORF037841	ABM	1.0 ug DNA	EUR 506

ABI3 ELISA Kit (Human) (OKEH08036)
OKEH08036	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: This gene encodes a member of an adaptor protein family. Members of this family encode proteins containing a homeobox homology domain, proline rich region and Src-homology 3 (SH3) domain, and are components of the Abi/WAVE complex which regulates actin polymerization. The encoded protein inhibits ectopic metastasis of tumor cells as well as cell migration. This may be accomplished through interaction with p21-activated kinase. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

ABI Gene Family Member 3 (ABI3) Antibody (HRP)
20-abx311285	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ABI Gene Family Member 3 (ABI3) Antibody (FITC)
20-abx311286	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ABI Gene Family Member 3 (ABI3) Antibody (Biotin)
20-abx311287	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Abi3 sgRNA CRISPR Lentivector set (Rat)
K6538801	ABM	3 x 1.0 ug	EUR 339

Abi3 sgRNA CRISPR Lentivector set (Mouse)
K3436701	ABM	3 x 1.0 ug	EUR 339

ABI3 sgRNA CRISPR Lentivector set (Human)
K0023801	ABM	3 x 1.0 ug	EUR 339

Abi3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6538802	ABM	1.0 ug DNA	EUR 154

Abi3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6538803	ABM	1.0 ug DNA	EUR 154

Abi3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6538804	ABM	1.0 ug DNA	EUR 154

Abi3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3436702	ABM	1.0 ug DNA	EUR 154

Abi3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3436703	ABM	1.0 ug DNA	EUR 154

Abi3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3436704	ABM	1.0 ug DNA	EUR 154

ABI3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0023802	ABM	1.0 ug DNA	EUR 154

ABI3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0023803	ABM	1.0 ug DNA	EUR 154

ABI3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0023804	ABM	1.0 ug DNA	EUR 154

ABI3 Protein Vector (Mouse) (pPB-C-His)
PV151358	ABM	500 ng	EUR 603

ABI3 Protein Vector (Mouse) (pPB-N-His)
PV151359	ABM	500 ng	EUR 603

ABI3 Protein Vector (Mouse) (pPM-C-HA)
PV151360	ABM	500 ng	EUR 603

ABI3 Protein Vector (Mouse) (pPM-C-His)
PV151361	ABM	500 ng	EUR 603

ABI3 Protein Vector (Mouse) (pPB-C-His)
PV151362	ABM	500 ng	EUR 603

ABI3 Protein Vector (Mouse) (pPB-N-His)
PV151363	ABM	500 ng	EUR 603

ABI3 Protein Vector (Mouse) (pPM-C-HA)
PV151364	ABM	500 ng	EUR 603

ABI3 Protein Vector (Mouse) (pPM-C-His)
PV151365	ABM	500 ng	EUR 603

ABI3 Protein Vector (Rat) (pPB-C-His)
PV251594	ABM	500 ng	EUR 603

ABI3 Protein Vector (Rat) (pPB-N-His)
PV251595	ABM	500 ng	EUR 603

ABI3 Protein Vector (Rat) (pPM-C-HA)
PV251596	ABM	500 ng	EUR 603

ABI3 Protein Vector (Rat) (pPM-C-His)
PV251597	ABM	500 ng	EUR 603

ABI3 Protein Vector (Human) (pPB-His-MBP)
PV318982	ABM	500 ng	EUR 329

ABI3 Protein Vector (Human) (pPB-His-GST)
PV318983	ABM	500 ng	EUR 329

ABI3 Protein Vector (Human) (pPB-C-His)
PV000205	ABM	500 ng	EUR 329

ABI3 Protein Vector (Human) (pPB-N-His)
PV000206	ABM	500 ng	EUR 329

ABI3 Protein Vector (Human) (pPM-C-HA)
PV000207	ABM	500 ng	EUR 329

ABI3 Protein Vector (Human) (pPM-C-His)
PV000208	ABM	500 ng	EUR 329

Recombinant Human ABI3 Protein, His, E.coli-100ug
QP10928-100ug	EnQuireBio	100ug	EUR 1261

Recombinant Human ABI3 Protein, His, E.coli-10ug
QP10928-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human ABI3 Protein, His, E.coli-2ug
QP10928-2ug	EnQuireBio	2ug	EUR 155

Abi3 3'UTR Luciferase Stable Cell Line
TU101197	ABM	1.0 ml	Ask for price

Abi3 3'UTR GFP Stable Cell Line
TU151197	ABM	1.0 ml	Ask for price

for Abl Interactor 3 (ABI3)ELISA kit
SEK183Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

for Abl Interactor 3 (ABI3)ELISA kit
SEK183Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

for Abl Interactor 3 (ABI3)ELISA kit
SEK183Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

for Abl Interactor 3 (ABI3)ELISA kit
SEK183Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

ELISA Kit for Abl Interactor 3 (ABI3)
4-SEK183Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Abl Interactor 3 elisa. Alternative names of the recognized antigen: NESH SSH3BP3 New molecule including SH3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Abl Interactor 3 (ABI3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Abi3 3'UTR Luciferase Stable Cell Line
TU200104	ABM	1.0 ml	Ask for price

Abi3 3'UTR GFP Stable Cell Line
TU250104	ABM	1.0 ml	Ask for price

ABI3 3'UTR GFP Stable Cell Line
TU050110	ABM	1.0 ml	EUR 1394

ABI3 3'UTR Luciferase Stable Cell Line
TU000110	ABM	1.0 ml	EUR 1394

ABI3 ABI Family, Member 3 Human Recombinant Protein
PROTQ9P2A4	BosterBio	Regular: 10ug	EUR 317
Description: ABI3 Human Recombinant produced in E. coli is a single polypeptide chain containing 389 amino acids (1-366) and having a molecular mass of 41.4 kDa.;ABI3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

ABI3 Rabbit Polyclonal Antibody