NOX4 Rabbit Polyclonal Antibody

NOX4 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    NOX4 Polyclonal Antibody

    ABP59498-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human NOX4 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of NOX4 from Human, Mouse, Rat. This NOX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOX4 protein

    NOX4 Polyclonal Antibody

    ABP59498-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human NOX4 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of NOX4 from Human, Mouse, Rat. This NOX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOX4 protein

    NOX4 Polyclonal Antibody

    ABP59498-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human NOX4 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of NOX4 from Human, Mouse, Rat. This NOX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOX4 protein

    NOX4 Polyclonal Antibody

    ES11921-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NOX4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    NOX4 Polyclonal Antibody

    ES11921-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NOX4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    NOX4 Rabbit pAb

    A11274-100ul 100 ul
    EUR 308

    NOX4 Rabbit pAb

    A11274-200ul 200 ul
    EUR 459

    NOX4 Rabbit pAb

    A11274-20ul 20 ul
    EUR 183

    NOX4 Rabbit pAb

    A11274-50ul 50 ul
    EUR 223

    NOX4 Rabbit mAb

    A3656-100ul 100 ul
    EUR 410

    NOX4 Rabbit mAb

    A3656-200ul 200 ul
    EUR 571

    NOX4 Rabbit mAb

    A3656-20ul 20 ul
    EUR 221

    NOX4 Rabbit mAb

    A3656-50ul 50 ul
    EUR 287

    Anti-NOX4 Rabbit Monoclonal Antibody

    M00403 100ug/vial
    EUR 397
    Description: Rabbit Monoclonal NOX4 Antibody. Validated in IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

    Polyclonal NOX4 Antibody (N-Terminus)

    APR08788G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOX4 (N-Terminus). This antibody is tested and proven to work in the following applications:

    NOX4 Polyclonal Antibody, HRP Conjugated

    A63035 100 µg
    EUR 570.55
    Description: reagents widely cited

    NOX4 Polyclonal Antibody, FITC Conjugated

    A63036 100 µg
    EUR 570.55
    Description: Ask the seller for details

    NOX4 Polyclonal Antibody, Biotin Conjugated

    A63037 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Nox4 Polyclonal Antibody, Biotin Conjugated

    A54536 100 µg
    EUR 570.55
    Description: reagents widely cited

    Nox4 Polyclonal Antibody, FITC Conjugated

    A54537 100 µg
    EUR 570.55
    Description: Ask the seller for details

    Nox4 Polyclonal Antibody, HRP Conjugated

    A54538 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Rabbit NOX4 ELISA Kit

    ERTN0050 96Tests
    EUR 521

    NOX4 antibody

    70R-18930 50 ul
    EUR 435
    Description: Rabbit polyclonal NOX4 antibody

    NOX4 Antibody

    32663-100ul 100ul
    EUR 252

    NOX4 Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

    NOX4 Antibody

    DF6924 200ul
    EUR 304
    Description: NOX4 Antibody detects endogenous levels of total NOX4.

    NOX4 Antibody

    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

    NOX4 Antibody

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

    Nox4 Antibody

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat, Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

    NOX4 Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

    NOX4 antibody

    70R-50972 100 ul
    EUR 244
    Description: Purified Polyclonal NOX4 antibody

    NOX4 Antibody

    ABD6924 100 ug
    EUR 438

    Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    DLR-NOX4-Hu-48T 48T
    EUR 498
    • Should the Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    DLR-NOX4-Hu-96T 96T
    EUR 647
    • Should the Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

    Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    DLR-NOX4-Mu-48T 48T
    EUR 508
    • Should the Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

    Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    DLR-NOX4-Mu-96T 96T
    EUR 661
    • Should the Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

    Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    DLR-NOX4-Ra-48T 48T
    EUR 528
    • Should the Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

    Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    DLR-NOX4-Ra-96T 96T
    EUR 690
    • Should the Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    RDR-NOX4-Hu-48Tests 48 Tests
    EUR 522

    Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    RDR-NOX4-Hu-96Tests 96 Tests
    EUR 724

    Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    RDR-NOX4-Mu-48Tests 48 Tests
    EUR 534

    Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    RDR-NOX4-Mu-96Tests 96 Tests
    EUR 742

    Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    RDR-NOX4-Ra-48Tests 48 Tests
    EUR 558

    Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    RDR-NOX4-Ra-96Tests 96 Tests
    EUR 776

    Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    RD-NOX4-Hu-48Tests 48 Tests
    EUR 500

    Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    RD-NOX4-Hu-96Tests 96 Tests
    EUR 692

    Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    RD-NOX4-Mu-48Tests 48 Tests
    EUR 511

    Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    RD-NOX4-Mu-96Tests 96 Tests
    EUR 709

    Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    RD-NOX4-Ra-48Tests 48 Tests
    EUR 534

    Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

    RD-NOX4-Ra-96Tests 96 Tests
    EUR 742

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNUM1245-50 50uL
    EUR 395
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245), 1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNUB1245-100 100uL
    EUR 209
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245), Concentration: 0.2mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNUB1245-500 500uL
    EUR 458
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245), Concentration: 0.2mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC551245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF555 conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC551245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF555 conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC611245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF660R conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC611245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF660R conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC471245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF647 conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC471245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF647 conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC051245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405M conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC051245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405M conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC401245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF640R conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC401245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF640R conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC431245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF543 conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC431245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF543 conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC041245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405S conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC041245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405S conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC801245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680 conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC801245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680 conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNCP1245-250 250uL
    EUR 383
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),PerCP conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNCR1245-250 250uL
    EUR 383
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),RPE conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNCA1245-250 250uL
    EUR 383
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),APC conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNCB1245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Biotin conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNCB1245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Biotin conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNCH1245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNCH1245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC881245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF488A conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC881245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF488A conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC941245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF594 conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC941245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF594 conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC681245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF568 conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC681245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF568 conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC701245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF770 conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC701245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF770 conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNCAP1245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNCAP1245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC811245-100 100uL
    EUR 199
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680R conjugate, Concentration: 0.1mg/mL

    NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

    BNC811245-500 500uL
    EUR 544
    Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680R conjugate, Concentration: 0.1mg/mL

    Rabbit Anti-NOX4 monoclonal antibody, clone TZ1325

    CABT-38500RH 100 ul
    EUR 777

    NOX4 Conjugated Antibody

    C32663 100ul
    EUR 397

    anti- NOX4 antibody

    FNab05806 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:200-1:2000
    • IP: 1:500-1:2000
    • IHC: 1:100-1:400
    • IF: 1:10-1:100
    • Immunogen: NADPH oxidase 4
    • Uniprot ID: Q9NPH5
    • Gene ID: 50507
    • Research Area: Metabolism
    Description: Antibody raised against NOX4

    Anti-NOX4 antibody

    PAab05806 100 ug
    EUR 386

    Anti-NOX4 antibody

    STJ24791 100 µl
    EUR 277
    Description: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.

    Anti-NOX4 antibody

    STJ113053 100 µl
    EUR 277
    Description: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.

    Anti-NOX4 antibody

    STJ193079 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to NOX4

    Nox4/ Rat Nox4 ELISA Kit

    ELI-04894r 96 Tests
    EUR 886

    NOX4 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    NOX4 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    NOX4 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    NOX4 Antibody, HRP conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    Nox4 Antibody, HRP conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

    NOX4 Antibody, FITC conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    Nox4 Antibody, FITC conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

    NOX4 Antibody, Biotin conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Nox4 Antibody, Biotin conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

    NOX4 recombinant monoclonal antibody

    A5258 100ul X 3
    EUR 595
    • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
    • Show more
    Description: A recombinant monoclonal antibody from rabbit against human NOX4 for WB, IHC, IF,ELISA

    Rabbit NADPH Oxidase 4 (NOX4) ELISA Kit

    abx363460-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    NADPH oxidase 4/NOX4 Antibody

    48782-100ul 100ul
    EUR 333

    NADPH oxidase 4/NOX4 Antibody

    48782-50ul 50ul
    EUR 239

    NADPH Oxidase 4 (NOX4) Antibody

    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody

    abx027743-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody

    abx027743-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody

    abx016156-100ug 100 ug
    EUR 411
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody

    abx216479-100ug 100 ug
    EUR 439
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody

    abx224134-100ug 100 ug
    EUR 411
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody

    abx125425-50ul 50 ul
    EUR 411
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody

    abx146310-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Monoclonal NOX4 Antibody, Clone: 3H2C4

    APR08785G 0.1ml
    EUR 528
    Description: A Monoclonal antibody against Human NOX4. The antibodies are raised in Mouse and are from clone 3H2C4. This antibody is applicable in WB and IHC, FC, ICC, E

    Monoclonal NOX4 Antibody, Clone: 3H2G11

    APR08786G 0.1ml
    EUR 528
    Description: A Monoclonal antibody against Human NOX4. The antibodies are raised in Mouse and are from clone 3H2G11. This antibody is applicable in WB and IHC, FC, ICC, E

    NADPH Oxidase 4 (NOX4) Antibody

    abx235806-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    NADPH Oxidase 4 (NOX4) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    NOX4 Blocking Peptide

    DF6924-BP 1mg
    EUR 195

    NOX4 Blocking Peptide

    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.

    NOX4 cloning plasmid

    CSB-CL015961HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1737
    • Sequence: atggctgtgtcctggaggagctggctcgccaacgaaggggttaaacacctctgcctgttcatctggctctccatgaatgtcctgcttttctggaaaaccttcttgctgtataaccaagggccagagtatcactacctccaccagatgttggggctaggattgtgtctaagcagag
    • Show more
    Description: A cloning plasmid for the NOX4 gene.

    Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human)

    • EUR 239.00
    • EUR 2391.00
    • EUR 598.00
    • EUR 299.00
    • EUR 211.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: NOX4 (Asp220~Asp392)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4)

    Anti-NADPH oxidase 4/NOX4 Antibody

    A00403 100ug/vial
    EUR 334

    NADPH Oxidase 4 (NOX4) Antibody (Biotin)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody (FITC)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody (HRP)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    NADPH oxidase 4/NOX4 Conjugated Antibody

    C48782 100ul
    EUR 397

    NADPH Oxidase 4 (NOX4) Antibody (HRP)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    NADPH Oxidase 4 (NOX4) Antibody (FITC)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    NOX4 Rabbit Polyclonal Antibody