CD3G Rabbit Polyclonal Antibody

CD3G Rabbit Polyclonal Antibody

Contact Us Below To Order :

    CD3G Polyclonal Antibody

    ES11786-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD3G from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    CD3G Rabbit pAb

    A1938-100ul 100 ul
    EUR 308

    CD3G Rabbit pAb

    A1938-200ul 200 ul
    EUR 459

    CD3G Rabbit pAb

    A1938-20ul 20 ul
    EUR 183

    CD3G Rabbit pAb

    A1938-50ul 50 ul Ask for price

    CD3G antibody

    70R-16274 50 ul
    EUR 435
    Description: Rabbit polyclonal CD3G antibody

    CD3G Antibody

    49836-100ul 100ul
    EUR 333

    CD3G Antibody

    49836-50ul 50ul
    EUR 239

    CD3G Antibody

    45216-100ul 100ul
    EUR 252

    CD3G Antibody

    45216-50ul 50ul
    EUR 187

    CD3G Antibody

    1-CSB-PA004933GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    CD3G Antibody

    1-CSB-PA004933LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

    CD3G Antibody

    DF8098 200ul
    EUR 304
    Description: CD3G Antibody detects endogenous levels of total CD3G.

    CD3g antibody

    70R-51259 100 ul
    EUR 244
    Description: Purified Polyclonal CD3g antibody

    CD3G Antibody

    ABD8098 100 ug
    EUR 438

    CD3G Antibody

    ABD8099 100 ug
    EUR 438

    CD3G

    PR27294 5 ug
    EUR 318

    Human CD3G Antibody

    35697-05111 150 ug
    EUR 261

    CD3G Conjugated Antibody

    C49836 100ul
    EUR 397

    Anti-CD3G antibody

    STJ28124 100 µl
    EUR 277
    Description: The protein encoded by this gene is the CD3-gamma polypeptide, which together with CD3-epsilon, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. Defects in this gene are associated with T cell immunodeficiency.

    Anti-CD3G Antibody

    STJ500451 100 µg
    EUR 476

    Anti-CD3G antibody

    STJ192944 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to CD3G

    Anti-CD3G antibody

    STJ73095 100 µg
    EUR 359

    Cd3g/ Rat Cd3g ELISA Kit

    ELI-25761r 96 Tests
    EUR 886

    Polyclonal Goat Anti-CD3G Antibody (internal region)

    APG00967G 0.1mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CD3G (internal region). This antibody is tested and proven to work in the following applications:

    CD3G siRNA

    20-abx900911
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    CD3G siRNA

    20-abx911027
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    CD3G siRNA

    20-abx911028
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    CD3G Antibody, HRP conjugated

    1-CSB-PA004933LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    CD3G Antibody, FITC conjugated

    1-CSB-PA004933LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    CD3G Antibody, Biotin conjugated

    1-CSB-PA004933LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    CD3G recombinant monoclonal antibody

    A5842 100ul X 3
    EUR 595
    • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
    • Show more
    Description: A recombinant monoclonal antibody from rabbit against human CD3G for WB,ELISA

    Anti-CD3G Antibody (Biotin)

    STJ500466 100 µg
    EUR 586

    Anti-CD3G Antibody (FITC)

    STJ500467 100 µg
    EUR 586

    CD3G Blocking Peptide

    DF8098-BP 1mg
    EUR 195

    CD3G, human recombinant

    7313-100
    EUR 370

    CD3g Blocking Peptide

    20-abx064134
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.

    CD3G cloning plasmid

    CSB-CL004933HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 549
    • Sequence: ATGGAACAGGGGAAGGGCCTGGCTGTCCTCATCCTGGCTATCATTCTTCTTCAAGGTACTTTGGCCCAGTCAATCAAAGGAAACCACTTGGTTAAGGTGTATGACTATCAAGAAGATGGTTCGGTACTTCTGACTTGTGATGCAGAAGCCAAAAATATCACATGGTTTAAAGATGG
    • Show more
    Description: A cloning plasmid for the CD3G gene.

    Human CD3G Antibody (Biotin Conjugate)

    35697-05121 150 ug
    EUR 369

    Human CD3G AssayLite Antibody (FITC Conjugate)

    35697-05141 150 ug
    EUR 428

    Human CD3G AssayLite Antibody (RPE Conjugate)

    35697-05151 150 ug
    EUR 428

    Human CD3G AssayLite Antibody (APC Conjugate)

    35697-05161 150 ug
    EUR 428

    Human CD3G AssayLite Antibody (PerCP Conjugate)

    35697-05171 150 ug
    EUR 471

    CD3G protein (His tag)

    80R-2704 100 ug
    EUR 322
    Description: Purified recombinant CD3G protein (His tag)

    Human CD3G ELISA Kit

    ELA-E10023h 96 Tests
    EUR 824

    Mouse Cd3g ELISA KIT

    ELI-10625m 96 Tests
    EUR 865

    Human CD3G ELISA KIT

    ELI-10660h 96 Tests
    EUR 824

    Rat CD3G shRNA Plasmid

    20-abx989067
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse CD3G shRNA Plasmid

    20-abx969567
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human CD3G shRNA Plasmid

    20-abx950646
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Bovine CD3G ELISA KIT

    ELI-50827b 96 Tests
    EUR 928

    CD3G Recombinant Protein (Human)

    RP037918 100 ug Ask for price

    CD3G Recombinant Protein (Rat)

    RP193961 100 ug Ask for price

    CD3G Recombinant Protein (Mouse)

    RP122588 100 ug Ask for price

    Cd3g ORF Vector (Rat) (pORF)

    ORF064655 1.0 ug DNA
    EUR 506

    CD3G ORF Vector (Human) (pORF)

    ORF012640 1.0 ug DNA
    EUR 95

    Cd3g ORF Vector (Mouse) (pORF)

    ORF040864 1.0 ug DNA
    EUR 506

    CD3G ELISA Kit (Bovine) (OKEH07517)

    OKEH07517 96 Wells
    EUR 1092
    Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

    CD3G ELISA Kit (Pig) (OKEH07518)

    OKEH07518 96 Wells
    EUR 1092
    Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

    CD3G ELISA Kit (Human) (OKEI00333)

    OKEI00333 96 Wells
    EUR 767
    Description: Description of target: The CD3 complex mediates signal transduction. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

    CD3G sgRNA CRISPR Lentivector set (Human)

    K0399801 3 x 1.0 ug
    EUR 339

    Cd3g sgRNA CRISPR Lentivector set (Rat)

    K6288201 3 x 1.0 ug
    EUR 339

    Cd3g sgRNA CRISPR Lentivector set (Mouse)

    K3425401 3 x 1.0 ug
    EUR 339

    h CD3g (6His) inducible lentiviral particles

    LVP1093 1x107 IFU/ml x 200ul
    EUR 451
    Description: Pre-made over-expression lentivirus for expressing C-terminal His-Tagged human target: CD3g (6His) (human CD3g molecule), [alternative names: CD3-GAMMA; IMD17; T3G]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_000073.2 . It contains a RFP-Blasticidin dual selection marker.

    CD3G CD3 Gamma Human Recombinant Protein

    PROTP09693 Regular: 20ug
    EUR 317
    Description: CD3G Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 117 amino acids (23-116a.a.) and having a molecular mass of 13.1kDa. CD3G is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

    T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3g) Antibody

    20-abx007885
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody

    20-abx111481
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody

    20-abx123523
    • EUR 411.00
    • EUR 592.00
    • 100 ul
    • 200 ul
    • Shipped within 5-10 working days.

    T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody

    20-abx149086
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody

    abx028446-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody

    abx028446-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    T-cell surface glycoprotein CD3 gamma chain (CD3G) Antibody

    20-abx338816
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody

    abx431152-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    Recombinant CD3E&CD3G Heterodimer Protein (Asp 23-Asp 126 (CD3E) & Gln 23-Ser 116 (CD3G)) [Fc]

    VAng-1294Lsx-1mg 1 mg
    EUR 7749
    Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc,His Tag&Fc,Flag Tag, is expressed in HEK 293 cells. (Uniprot ID: NP_000724.1 (CD3E) & AAI13831 (CD3G))

    Recombinant CD3E&CD3G Heterodimer Protein (Asp 23-Asp 126 (CD3E) & Gln 23-Ser 116 (CD3G)) [Fc]

    VAng-1294Lsx-50g 50 µg
    EUR 1013
    Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc,His Tag&Fc,Flag Tag, is expressed in HEK 293 cells. (Uniprot ID: NP_000724.1 (CD3E) & AAI13831 (CD3G))

    Recombinant CD3E&CD3G Heterodimer Protein (Gln 22-Asp 117 (CD3E) & Gln 23-Thr 113 (CD3G)) [Fc]

    VAng-1295Lsx-100g 100 µg
    EUR 1013
    Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc Tag, is expressed in HEK 293 cells. (Uniprot ID: Q95LI5-1 (CD3E) & Q95LI7-1 (CD3G))

    Recombinant CD3E&CD3G Heterodimer Protein (Gln 22-Asp 117 (CD3E) & Gln 23-Thr 113 (CD3G)) [Fc]

    VAng-1295Lsx-1mg 1 mg
    EUR 6402
    Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc Tag, is expressed in HEK 293 cells. (Uniprot ID: Q95LI5-1 (CD3E) & Q95LI7-1 (CD3G))

    CD3G sgRNA CRISPR Lentivector (Human) (Target 1)

    K0399802 1.0 ug DNA
    EUR 154

    CD3G sgRNA CRISPR Lentivector (Human) (Target 2)

    K0399803 1.0 ug DNA
    EUR 154

    CD3G sgRNA CRISPR Lentivector (Human) (Target 3)

    K0399804 1.0 ug DNA
    EUR 154

    Cd3g sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6288202 1.0 ug DNA
    EUR 154

    Cd3g sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6288203 1.0 ug DNA
    EUR 154

    Cd3g sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6288204 1.0 ug DNA
    EUR 154

    Cd3g sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3425402 1.0 ug DNA
    EUR 154

    Cd3g sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3425403 1.0 ug DNA
    EUR 154

    Cd3g sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3425404 1.0 ug DNA
    EUR 154

    CD3G Protein Vector (Mouse) (pPB-C-His)

    PV163454 500 ng
    EUR 603

    CD3G Protein Vector (Mouse) (pPB-N-His)

    PV163455 500 ng
    EUR 603

    CD3G Protein Vector (Mouse) (pPM-C-HA)

    PV163456 500 ng
    EUR 603

    CD3G Protein Vector (Mouse) (pPM-C-His)

    PV163457 500 ng
    EUR 603

    CD3G Protein Vector (Rat) (pPB-C-His)

    PV258618 500 ng
    EUR 603

    CD3G Protein Vector (Rat) (pPB-N-His)

    PV258619 500 ng
    EUR 603

    CD3G Protein Vector (Rat) (pPM-C-HA)

    PV258620 500 ng
    EUR 603

    CD3G Protein Vector (Rat) (pPM-C-His)

    PV258621 500 ng
    EUR 603

    CD3G Protein Vector (Human) (pPB-C-His)

    PV050557 500 ng
    EUR 481

    CD3G Protein Vector (Human) (pPB-N-His)

    PV050558 500 ng
    EUR 481

    CD3G Rabbit Polyclonal Antibody