GSTM1 Rabbit Polyclonal Antibody

GSTM1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

GSTM1 Polyclonal Antibody
ABP58729-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human GSTM1 protein Applications tips:
Description: A polyclonal antibody for detection of GSTM1 from Human, Mouse, Rat. This GSTM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTM1 protein

GSTM1 Polyclonal Antibody
ABP58729-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human GSTM1 protein Applications tips:
Description: A polyclonal antibody for detection of GSTM1 from Human, Mouse, Rat. This GSTM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTM1 protein

GSTM1 Polyclonal Antibody
ABP58729-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human GSTM1 protein Applications tips:
Description: A polyclonal antibody for detection of GSTM1 from Human, Mouse, Rat. This GSTM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTM1 protein

GSTM1 Polyclonal Antibody
ES11905-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GSTM1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GSTM1 Polyclonal Antibody
ES11905-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GSTM1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GSTM1 Rabbit pAb
A8819-100ul	Abclonal	100 ul	EUR 308

GSTM1 Rabbit pAb
A8819-200ul	Abclonal	200 ul	EUR 459

GSTM1 Rabbit pAb
A8819-20ul	Abclonal	20 ul	Ask for price

GSTM1 Rabbit pAb
A8819-50ul	Abclonal	50 ul	Ask for price

GSTM1 Rabbit pAb
A17492-100ul	Abclonal	100 ul	EUR 308

GSTM1 Rabbit pAb
A17492-200ul	Abclonal	200 ul	EUR 459

GSTM1 Rabbit pAb
A17492-20ul	Abclonal	20 ul	EUR 183

GSTM1 Rabbit pAb
A17492-50ul	Abclonal	50 ul	EUR 223

GSTM1 Polyclonal Conjugated Antibody
C30053	SAB	100ul	EUR 397

Polyclonal GSTM1 / MU Antibody
AMM05244G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GSTM1 / MU . This antibody is tested and proven to work in the following applications:

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit
DLR-GSTm1-Hu-48T	DL Develop	48T	EUR 479
Should the Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione S Transferase Mu 1 (GSTm1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit
DLR-GSTm1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione S Transferase Mu 1 (GSTm1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit
RDR-GSTm1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit
RDR-GSTm1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit
RD-GSTm1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit
RD-GSTm1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Polyclonal GSTM1 Antibody (C-term)
AMM05246G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GSTM1 (C-term). This antibody is tested and proven to work in the following applications:

GSTM1 antibody
23009-100ul	SAB	100ul	EUR 390

GSTM1 antibody
70R-17626	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GSTM1 antibody

GSTM1 antibody
70R-13538	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal GSTM1 antibody

GSTM1 antibody
10R-10423	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal GSTM1 antibody

GSTM1 antibody
70R-49833	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal GSTM1 antibody

GSTM1 antibody
70R-8515	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal GSTM1 antibody

GSTM1 antibody
70R-5348	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GSTM1 antibody raised against the N terminal of GSTM1

GSTM1 Antibody
BF0243	Affbiotech	200ul	EUR 376
Description: GSTM1 antibody detects endogenous levels of total GSTM1.

GSTM1 Antibody
1-CSB-PA009979GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

GSTM1 Antibody
1-CSB-PA009979LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GSTM1 antibody
PAab09906	Lifescience Market	100 ug	EUR 386

GSTM1 antibody
PAab09966	Lifescience Market	100 ug	EUR 386

Polyclonal Goat Anti-GSTM1 / GSTM2 Antibody
AMM05005G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GSTM1 / GSTM2 . This antibody is tested and proven to work in the following applications:

Polyclonal GSTM1 antibody - N-terminal region
AMM05248G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GSTM1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Mouse GSTM1 Antibody
32935-05111	AssayPro	150 ug	EUR 261

Anti-GSTM1 Antibody
A00569-1	BosterBio	100ug/vial	EUR 294

anti- GSTM1 antibody
FNab03692	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IHC: 1:50-1:500 IF: 1:50-1:500 Immunogen: glutathione S-transferase mu 1 Uniprot ID: P09488 Gene ID: 2944 Research Area: Metabolism
Description: Antibody raised against GSTM1

anti- GSTM1 antibody
FNab09906	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IHC: 1:50-1:200 Immunogen: glutathione S-transferase mu 1 Uniprot ID: P09488 Gene ID: 2944 Research Area: Metabolism
Description: Antibody raised against GSTM1

anti- GSTM1 antibody
FNab09966	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IHC: 1:20-1:200 Immunogen: glutathione S-transferase mu 1 Uniprot ID: P09488 Gene ID: 2944 Research Area: Metabolism
Description: Antibody raised against GSTM1

anti- GSTM1 antibody
LSMab09906	Lifescience Market	100 ug	EUR 386

anti- GSTM1 antibody
LSMab09966	Lifescience Market	100 ug	EUR 386

Anti-GSTM1 antibody
PAab03692	Lifescience Market	100 ug	EUR 386

Anti-GSTM1 antibody
STJ111433	St John's Laboratory	100 µl	EUR 277
Description: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Null mutations of this class mu gene have been linked with an increase in a number of cancers, likely due to an increased susceptibility to environmental toxins and carcinogens. Multiple protein isoforms are encoded by transcript variants of this gene.

Anti-GSTM1 antibody
STJ119590	St John's Laboratory	100 µl	EUR 277
Description: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Null mutations of this class mu gene have been linked with an increase in a number of cancers, likely due to an increased susceptibility to environmental toxins and carcinogens. Multiple protein isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]

Anti-GSTM1 antibody
STJ193063	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GSTM1

Gstm1/ Rat Gstm1 ELISA Kit
ELI-48471r	Lifescience Market	96 Tests	EUR 886

GSTM1 protein
30R-1261	Fitzgerald	100 ug	EUR 300
Description: Purified recombinant Mouse GSTM1 protein

GSTM1 siRNA
20-abx902353	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GSTM1 siRNA
20-abx918818	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GSTM1 siRNA
20-abx918819	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GSTM1 Antibody, HRP conjugated
1-CSB-PA009979LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GSTM1 Antibody, FITC conjugated
1-CSB-PA009979LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GSTM1 Antibody, Biotin conjugated
1-CSB-PA009979LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-GSTM1 / GSTM2 antibody
STJ70642	St John's Laboratory	100 µg	EUR 359

GSTM1 Blocking Peptide
33R-4498	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSTM1 antibody, catalog no. 70R-5348

GSTM1 Blocking Peptide
33R-7049	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSTM1 antibody, catalog no. 70R-8515

GSTM1 Blocking Peptide
20-abx062708	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

GSTM1 Blocking Peptide
BF0243-BP	Affbiotech	1mg	EUR 195

GSTM1 cloning plasmid
CSB-CL009979HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 546 Sequence: atgcccatgatactggggtactgggacatccgcgggctggcccacgccatccgcctgctcctggaatacacagactcaagctatgaggaaaagaagtacacgatgggggacgctcctgattatgacagaagccagtggctgaatgaaaaattcaagctgggcctggactttcccaa Show more
Description: A cloning plasmid for the GSTM1 gene.

anti-GSTM1 (1H4A4)
LF-MA30658	Abfrontier	100 ul	EUR 527
Description: Mouse Monoclonal to GSTM1

anti-GSTM1 (1H4F2)
LF-MA30659	Abfrontier	100 ul	EUR 527
Description: Mouse Monoclonal to GSTM1

Anti-GSTM1 (3B10)
YF-MA13347	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GSTM1

Mouse GSTM1 Antibody (Biotin Conjugate)
32935-05121	AssayPro	150 ug	EUR 369

Monoclonal GSTM1 Antibody, Clone: 1H4F2
APR16645G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human GSTM1. The antibodies are raised in Mouse and are from clone 1H4F2. This antibody is applicable in WB and IHC, FC, E

Anti-GSTM1 Antibody (monoclonal, 11F2)
M00569	BosterBio	100ug/vial	EUR 334

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken)
4-PAA658Ga01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Glu220) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1)

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse)
4-PAA658Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1)

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat)
4-PAA658Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Ly218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1)

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), APC
4-PAA658Ga01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Glu220) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), Biotinylated
4-PAA658Ga01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Glu220) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), Cy3
4-PAA658Ga01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Glu220) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), FITC
4-PAA658Ga01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Glu220) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with FITC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), HRP
4-PAA658Ga01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Glu220) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with HRP.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), PE
4-PAA658Ga01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Glu220) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with PE.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), APC
4-PAA658Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), Biotinylated
4-PAA658Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), Cy3
4-PAA658Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), FITC
4-PAA658Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with FITC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), HRP
4-PAA658Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with HRP.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), PE
4-PAA658Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with PE.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), APC
4-PAA658Ra01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Ly218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), Biotinylated
4-PAA658Ra01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Ly218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), Cy3
4-PAA658Ra01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Ly218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), FITC
4-PAA658Ra01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Ly218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with FITC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), HRP
4-PAA658Ra01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Ly218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with HRP.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), PE
4-PAA658Ra01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm1 (Met1~Ly218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with PE.

Mouse GSTM1 AssayLite Antibody (FITC Conjugate)
32935-05141	AssayPro	150 ug	EUR 428

Mouse GSTM1 AssayLite Antibody (APC Conjugate)
32935-05151	AssayPro	150 ug	EUR 428

Mouse GSTM1 AssayLite Antibody (RPE Conjugate)
32935-05161	AssayPro	150 ug	EUR 428

Mouse GSTM1 AssayLite Antibody (PerCP Conjugate)
32935-05171	AssayPro	150 ug	EUR 471

GSTM1 protein (His tag)
80R-3744	Fitzgerald	50 ug	EUR 327
Description: Purified recombinant GSTM1 protein (His tag)

GSTM1 ELISA KIT|Human
EF010014	Lifescience Market	96 Tests	EUR 689

Rat GSTM1 shRNA Plasmid
20-abx984488	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GSTM1 shRNA Plasmid
20-abx951990	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GSTM1 shRNA Plasmid
20-abx970689	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GSTM1 Rabbit Polyclonal Antibody