TSHR Rabbit Polyclonal Antibody

TSHR Rabbit Polyclonal Antibody

Contact Us Below To Order :

    TSHR Polyclonal Antibody
    ABP60783-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360
    • Applications tips:
    Description: A polyclonal antibody for detection of TSHR from Human, Mouse, Rat. This TSHR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360
    TSHR Polyclonal Antibody
    ABP60783-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360
    • Applications tips:
    Description: A polyclonal antibody for detection of TSHR from Human, Mouse, Rat. This TSHR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360
    TSHR Polyclonal Antibody
    ES11649-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against TSHR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    TSHR Polyclonal Antibody
    ES11649-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against TSHR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    TSHR Rabbit pAb
    A1012-100ul 100 ul
    EUR 308
    TSHR Rabbit pAb
    A1012-200ul 200 ul
    EUR 459
    TSHR Rabbit pAb
    A1012-20ul 20 ul Ask for price
    TSHR Rabbit pAb
    A1012-50ul 50 ul Ask for price
    TSHR Rabbit pAb
    A6781-100ul 100 ul
    EUR 308
    TSHR Rabbit pAb
    A6781-200ul 200 ul
    EUR 459
    TSHR Rabbit pAb
    A6781-20ul 20 ul
    EUR 183
    TSHR Rabbit pAb
    A6781-50ul 50 ul
    EUR 223
    Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    DLR-TSHR-Hu-48T 48T
    EUR 517
    • Should the Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.
    Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    DLR-TSHR-Hu-96T 96T
    EUR 673
    • Should the Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.
    Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    DLR-TSHR-Mu-48T 48T
    EUR 527
    • Should the Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.
    Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    DLR-TSHR-Mu-96T 96T
    EUR 688
    • Should the Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.
    Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    DLR-TSHR-Ra-48T 48T
    EUR 549
    • Should the Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.
    Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    DLR-TSHR-Ra-96T 96T
    EUR 718
    • Should the Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.
    Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    RDR-TSHR-Hu-48Tests 48 Tests
    EUR 544
    Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    RDR-TSHR-Hu-96Tests 96 Tests
    EUR 756
    Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    RDR-TSHR-Mu-48Tests 48 Tests
    EUR 557
    Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    RDR-TSHR-Mu-96Tests 96 Tests
    EUR 774
    Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    RDR-TSHR-Ra-48Tests 48 Tests
    EUR 583
    Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    RDR-TSHR-Ra-96Tests 96 Tests
    EUR 811
    Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    RD-TSHR-Hu-48Tests 48 Tests
    EUR 521
    Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    RD-TSHR-Hu-96Tests 96 Tests
    EUR 723
    Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    RD-TSHR-Mu-48Tests 48 Tests
    EUR 533
    Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    RD-TSHR-Mu-96Tests 96 Tests
    EUR 740
    Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    RD-TSHR-Ra-48Tests 48 Tests
    EUR 557
    Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
    RD-TSHR-Ra-96Tests 96 Tests
    EUR 775
    TSHR Polyclonal Antibody, Biotin Conjugated
    A53711 100 µg
    EUR 570.55
    Description: reagents widely cited
    TSHR Polyclonal Antibody, FITC Conjugated
    A53712 100 µg
    EUR 570.55
    Description: Ask the seller for details
    TSHR Polyclonal Antibody, HRP Conjugated
    A53713 100 µg
    EUR 570.55
    Description: The best epigenetics products
    TSHR antibody
    70R-1187 100 ug
    EUR 377
    Description: Rabbit polyclonal TSHR antibody raised against the N terminal of TSHR
    TSHR antibody
    70R-21027 50 ul
    EUR 435
    Description: Rabbit polyclonal TSHR antibody
    TSHR antibody
    70R-2915 50 ug
    EUR 467
    Description: Rabbit polyclonal TSHR antibody raised against the C terminal of TSHR
    TSHR Antibody
    35980-100ul 100ul
    EUR 252
    TSHR antibody
    39177-100ul 100ul
    EUR 252
    TSHR Antibody
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
    TSHR Antibody
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
    TSHR Antibody
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
    TSHR Antibody
    DF12492 200ul
    EUR 304
    Description: TSHR antibody detects endogenous levels of TSHR.
    TSHR antibody
    70R-5997 50 ug
    EUR 467
    Description: Rabbit polyclonal TSHR antibody raised against the N terminal of TSHR
    TSHR antibody
    70R-6004 50 ug
    EUR 467
    Description: Rabbit polyclonal TSHR antibody raised against the N terminal of TSHR
    TSHR Antibody
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB
    TSHR Conjugated Antibody
    C35980 100ul
    EUR 397
    anti- TSHR antibody
    FNab09045 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500 - 1:2000
    • IHC: 1:50 - 1:200
    • IF: 1:20- 1:50
    • Immunogen: thyroid stimulating hormone receptor
    • Uniprot ID: P16473
    • Gene ID: 7253
    • Research Area: Cancer, Signal Transduction
    Description: Antibody raised against TSHR
    Anti-TSHR antibody
    PAab09045 100 ug
    EUR 386
    Anti-TSHR antibody
    STJ25983 100 µl
    EUR 277
    Description: The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene.
    Anti-TSHR antibody
    STJ28864 100 µl
    EUR 277
    Description: The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene.
    Anti-TSHR antibody
    STJ192807 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to TSHR
    Tshr/ Rat Tshr ELISA Kit
    ELI-16646r 96 Tests
    EUR 886
    Polyclonal TSH Receptor / TSHR Antibody (C-Terminus)
    APR13833G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSH Receptor / TSHR (C-Terminus). This antibody is tested and proven to work in the following applications:
    Polyclonal TSH Receptor / TSHR Antibody (C-Terminus)
    APR13834G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSH Receptor / TSHR (C-Terminus). This antibody is tested and proven to work in the following applications:
    Polyclonal TSH Receptor / TSHR Antibody (N-Terminus)
    APR13835G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSH Receptor / TSHR (N-Terminus). This antibody is tested and proven to work in the following applications:
    Polyclonal TSHR (aa101-115) Antibody (internal region)
    APR13836G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TSHR (aa101-115) (internal region). This antibody is tested and proven to work in the following applications:
    TSHR siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    TSHR siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    TSHR siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PVT18095 2 ug
    EUR 231
    TSHR Antibody, HRP conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    TSHR Antibody, FITC conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    TSHR Antibody, Biotin conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    Thyrotropin Receptor (TSHR) Antibody
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Thyrotropin Receptor (TSHR) Antibody
    • EUR 370.00
    • EUR 606.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Thyrotropin Receptor (TSHR) Antibody
    abx239045-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    Thyrotropin Receptor (TSHR) Antibody
    abx412917-02mg 0.2 mg
    EUR 648
    • Shipped within 1 week.
    Thyrotropin Receptor (TSHR) Antibody
    abx413193-02mg 0.2 mg
    EUR 648
    • Shipped within 1 week.
    Thyrotropin Receptor (TSHR) Antibody
    abx413194-20ug 20 ug
    EUR 300
    • Shipped within 1 week.
    Thyrotropin Receptor (TSHR) Antibody
    abx433417-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.
    Thyrotropin Receptor (TSHR) Antibody
    • EUR 411.00
    • EUR 592.00
    • 100 ul
    • 200 ul
    • Shipped within 5-10 working days.
    Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat)
    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TSHR (Pro28~Gly245)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR)
    TSHR Blocking Peptide
    33R-2549 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-6004
    TSHR Blocking Peptide
    33R-4502 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-2915
    TSHR Blocking Peptide
    33R-5481 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-5997
    TSHR Blocking Peptide
    33R-1711 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-1187
    TSHR Blocking Peptide
    DF12492-BP 1mg
    EUR 195
    TSHR 420 Protein
    • EUR 495.00
    • EUR 1595.00
    • 100 ug
    • 1 mg
    • Shipped within 5-10 working days.
    TSHR cloning plasmid
    CSB-CL025131HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 762
    • Sequence: atgaggccggcggacttgctgcagctggtgctgctgctcgacctgcccagggacctgggcggaatggggtgttcgtctccaccctgcgagtgccatcaggaggaggacttcagagtcacctgcaaggatattcaacgcatccccagcttaccgcccagtacgcagactctgaagct
    • Show more
    Description: A cloning plasmid for the TSHR gene.
    TSHR cloning plasmid
    CSB-CL025131HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 762
    • Sequence: atgaggccggcggacttgctgcagctggtgctgctgctcgacctgcccagggacctgggcggaatggggtgttcgtctccaccctgcgagtgccatcaggaggaggacttcagagtcacctgcaaggatattcaacgcatccccagcttaccgcccagtacgcagactctgaagct
    • Show more
    Description: A cloning plasmid for the TSHR gene.
    Recombinant Human TSHR
    P0062 100ug
    EUR 522.36
    • Formulation: More than 95% by SDS-PAGE gel analyses
    • Reconstitution: Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose, pH7.4
    • Purity: Thyroid-stimulating hormone receptor,TSH-R,LGR3
    • Uniprot ID: P16473
    Description: Recombinant Human protein for TSHR
    Anti-TSH Receptor/TSHR Antibody
    A00576-1 100ug/vial
    EUR 294
    Anti-TSH Receptor/TSHR Antibody
    PA2013 100ug/vial
    EUR 334
    Anti-TSHR (aa101-115) antibody
    STJ72663 100 µg
    EUR 359
    Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), APC
    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TSHR (Pro28~Gly245)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with APC.
    Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), Biotinylated
    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TSHR (Pro28~Gly245)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with Biotin.
    Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), Cy3
    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TSHR (Pro28~Gly245)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with Cy3.
    Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), FITC
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TSHR (Pro28~Gly245)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with FITC.
    Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), HRP
    • EUR 332.00
    • EUR 3089.00
    • EUR 866.00
    • EUR 421.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TSHR (Pro28~Gly245)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with HRP.
    Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), PE
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TSHR (Pro28~Gly245)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with PE.
    Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), APC-Cy7
    • EUR 608.00
    • EUR 6970.00
    • EUR 1840.00
    • EUR 814.00
    • EUR 335.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TSHR (Pro28~Gly245)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with APC-Cy7.
    Thyroid-Stimulating Hormone Receptor (TSHR) Antibody
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Thyroid-Stimulating Hormone Receptor (TSHR) Antibody
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Thyroid Stimulating Hormone Receptor (TSHR) Antibody
    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Thyroid Stimulating Hormone Receptor (TSHR) Antibody
    • EUR 913.00
    • EUR 467.00
    • 1 mg
    • 200 ug
    • Please enquire.
    ELI-16645d 96 Tests
    EUR 928
    Human TSHR ELISA Kit
    ELA-E9855h 96 Tests
    EUR 824
    EF006552 96 Tests
    EUR 689

    TSHR Rabbit Polyclonal Antibody