TSHR Rabbit Polyclonal Antibody

TSHR Rabbit Polyclonal Antibody

Contact Us Below To Order :

TSHR Polyclonal Antibody
ABP60783-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360 Applications tips:
Description: A polyclonal antibody for detection of TSHR from Human, Mouse, Rat. This TSHR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360

TSHR Polyclonal Antibody
ABP60783-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360 Applications tips:
Description: A polyclonal antibody for detection of TSHR from Human, Mouse, Rat. This TSHR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360

TSHR Polyclonal Antibody
ES11649-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TSHR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TSHR Polyclonal Antibody
ES11649-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TSHR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TSHR Rabbit pAb
A1012-100ul	Abclonal	100 ul	EUR 308

TSHR Rabbit pAb
A1012-200ul	Abclonal	200 ul	EUR 459

TSHR Rabbit pAb
A1012-20ul	Abclonal	20 ul	Ask for price

TSHR Rabbit pAb
A1012-50ul	Abclonal	50 ul	Ask for price

TSHR Rabbit pAb
A6781-100ul	Abclonal	100 ul	EUR 308

TSHR Rabbit pAb
A6781-200ul	Abclonal	200 ul	EUR 459

TSHR Rabbit pAb
A6781-20ul	Abclonal	20 ul	EUR 183

TSHR Rabbit pAb
A6781-50ul	Abclonal	50 ul	EUR 223

Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Hu-48T	DL Develop	48T	EUR 517
Should the Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Hu-96T	DL Develop	96T	EUR 673
Should the Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

TSHR Polyclonal Antibody, Biotin Conjugated
A53711	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

TSHR Polyclonal Antibody, FITC Conjugated
A53712	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

TSHR Polyclonal Antibody, HRP Conjugated
A53713	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

TSHR antibody
70R-1187	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal TSHR antibody raised against the N terminal of TSHR

TSHR antibody
70R-21027	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TSHR antibody

TSHR antibody
70R-2915	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal TSHR antibody raised against the C terminal of TSHR

TSHR Antibody
35980-100ul	SAB	100ul	EUR 252

TSHR antibody
39177-100ul	SAB	100ul	EUR 252

TSHR Antibody
1-CSB-PA11189A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

TSHR Antibody
1-CSB-PA973863	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TSHR Antibody
1-CSB-PA820027	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TSHR Antibody
DF12492	Affbiotech	200ul	EUR 304
Description: TSHR antibody detects endogenous levels of TSHR.

TSHR antibody
70R-5997	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal TSHR antibody raised against the N terminal of TSHR

TSHR antibody
70R-6004	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal TSHR antibody raised against the N terminal of TSHR

TSHR Antibody
1-CSB-PA025131GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TSHR Conjugated Antibody
C35980	SAB	100ul	EUR 397

anti- TSHR antibody
FNab09045	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:20- 1:50 Immunogen: thyroid stimulating hormone receptor Uniprot ID: P16473 Gene ID: 7253 Research Area: Cancer, Signal Transduction
Description: Antibody raised against TSHR

Anti-TSHR antibody
PAab09045	Lifescience Market	100 ug	EUR 386

Anti-TSHR antibody
STJ25983	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene.

Anti-TSHR antibody
STJ28864	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene.

Anti-TSHR antibody
STJ192807	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to TSHR

Tshr/ Rat Tshr ELISA Kit
ELI-16646r	Lifescience Market	96 Tests	EUR 886

Polyclonal TSH Receptor / TSHR Antibody (C-Terminus)
APR13833G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSH Receptor / TSHR (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal TSH Receptor / TSHR Antibody (C-Terminus)
APR13834G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSH Receptor / TSHR (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal TSH Receptor / TSHR Antibody (N-Terminus)
APR13835G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSH Receptor / TSHR (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal TSHR (aa101-115) Antibody (internal region)
APR13836G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TSHR (aa101-115) (internal region). This antibody is tested and proven to work in the following applications:

TSHR siRNA
20-abx905828	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TSHR siRNA
20-abx938292	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TSHR siRNA
20-abx938293	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-TSHR
PVT18095	Lifescience Market	2 ug	EUR 231

TSHR Antibody, HRP conjugated
1-CSB-PA11189B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TSHR Antibody, FITC conjugated
1-CSB-PA11189C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TSHR Antibody, Biotin conjugated
1-CSB-PA11189D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Thyrotropin Receptor (TSHR) Antibody
20-abx005203	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Thyrotropin Receptor (TSHR) Antibody
20-abx142283	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Thyrotropin Receptor (TSHR) Antibody
abx239045-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Thyrotropin Receptor (TSHR) Antibody
abx412917-02mg	Abbexa	0.2 mg	EUR 648
Shipped within 1 week.

Thyrotropin Receptor (TSHR) Antibody
abx413193-02mg	Abbexa	0.2 mg	EUR 648
Shipped within 1 week.

Thyrotropin Receptor (TSHR) Antibody
abx413194-20ug	Abbexa	20 ug	EUR 300
Shipped within 1 week.

Thyrotropin Receptor (TSHR) Antibody
abx433417-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Thyrotropin Receptor (TSHR) Antibody
20-abx000958	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat)
4-PAC825Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR)

TSHR Blocking Peptide
33R-2549	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-6004

TSHR Blocking Peptide
33R-4502	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-2915

TSHR Blocking Peptide
33R-5481	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-5997

TSHR Blocking Peptide
33R-1711	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-1187

TSHR Blocking Peptide
DF12492-BP	Affbiotech	1mg	EUR 195

TSHR 420 Protein
20-abx060300	Abbexa	EUR 495.00 EUR 1595.00	100 ug 1 mg
Shipped within 5-10 working days.

TSHR cloning plasmid
CSB-CL025131HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 762 Sequence: atgaggccggcggacttgctgcagctggtgctgctgctcgacctgcccagggacctgggcggaatggggtgttcgtctccaccctgcgagtgccatcaggaggaggacttcagagtcacctgcaaggatattcaacgcatccccagcttaccgcccagtacgcagactctgaagct Show more
Description: A cloning plasmid for the TSHR gene.

TSHR cloning plasmid
CSB-CL025131HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 762 Sequence: atgaggccggcggacttgctgcagctggtgctgctgctcgacctgcccagggacctgggcggaatggggtgttcgtctccaccctgcgagtgccatcaggaggaggacttcagagtcacctgcaaggatattcaacgcatccccagcttaccgcccagtacgcagactctgaagct Show more
Description: A cloning plasmid for the TSHR gene.

Recombinant Human TSHR
P0062	FN Test	100ug	EUR 522.36
Formulation: More than 95% by SDS-PAGE gel analyses Reconstitution: Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose, pH7.4 Purity: Thyroid-stimulating hormone receptor,TSH-R,LGR3 Uniprot ID: P16473
Description: Recombinant Human protein for TSHR

Anti-TSH Receptor/TSHR Antibody
A00576-1	BosterBio	100ug/vial	EUR 294

Anti-TSH Receptor/TSHR Antibody
PA2013	BosterBio	100ug/vial	EUR 334

Anti-TSHR (aa101-115) antibody
STJ72663	St John's Laboratory	100 µg	EUR 359

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), APC
4-PAC825Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with APC.

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), Biotinylated
4-PAC825Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with Biotin.

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), Cy3
4-PAC825Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with Cy3.

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), FITC
4-PAC825Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with FITC.

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), HRP
4-PAC825Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with HRP.

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), PE
4-PAC825Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with PE.

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), APC-Cy7
4-PAC825Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with APC-Cy7.

Thyroid-Stimulating Hormone Receptor (TSHR) Antibody
20-abx210603	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Thyroid-Stimulating Hormone Receptor (TSHR) Antibody
20-abx210604	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Thyroid Stimulating Hormone Receptor (TSHR) Antibody
20-abx130083	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thyroid Stimulating Hormone Receptor (TSHR) Antibody
20-abx174793	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Canine TSHR ELISA KIT
ELI-16645d	Lifescience Market	96 Tests	EUR 928

Human TSHR ELISA Kit
ELA-E9855h	Lifescience Market	96 Tests	EUR 824

TSHR ELISA KIT|Human
EF006552	Lifescience Market	96 Tests	EUR 689

TSHR Rabbit Polyclonal Antibody