OR5L1 Rabbit Polyclonal Antibody

OR5L1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    OR5L1 Polyclonal Antibody

    ABP59729-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human OR5L1 protein at amino acid sequence of 30-110
    • Applications tips:
    Description: A polyclonal antibody for detection of OR5L1 from Human. This OR5L1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OR5L1 protein at amino acid sequence of 30-110

    OR5L1 Polyclonal Antibody

    ABP59729-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human OR5L1 protein at amino acid sequence of 30-110
    • Applications tips:
    Description: A polyclonal antibody for detection of OR5L1 from Human. This OR5L1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OR5L1 protein at amino acid sequence of 30-110

    OR5L1 Polyclonal Antibody

    ES11711-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against OR5L1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    OR5L1 Polyclonal Antibody

    ES11711-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against OR5L1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    OR5L1 Antibody

    1-CSB-PA839894LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against OR5L1. Recognizes OR5L1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    OR5L1 Polyclonal Antibody, HRP Conjugated

    A66643 100 µg
    EUR 570.55
    Description: Ask the seller for details

    OR5L1 Polyclonal Antibody, FITC Conjugated

    A66644 100 µg
    EUR 570.55
    Description: The best epigenetics products

    OR5L1 Polyclonal Antibody, Biotin Conjugated

    A66645 100 µg
    EUR 570.55
    Description: kits suitable for this type of research

    OR5L1/2 Antibody

    44613-100ul 100ul
    EUR 252

    OR5L1/2 Antibody

    44613-50ul 50ul
    EUR 187

    OR5L1/2 Antibody

    DF10254 200ul
    EUR 304
    Description: OR5L1/2 Antibody detects endogenous levels of total OR5L1/2.

    OR5L1/2 antibody

    70R-36509 100 ug
    EUR 327
    Description: Rabbit polyclonal OR5L1/2 antibody

    OR5L1 / 2 Antibody

    20-abx217448
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    OR5L1/OR5L2 Antibody

    1-CSB-PA008195
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against OR5L1/OR5L2. Recognizes OR5L1/OR5L2 from Human. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/5000

    OR5L1 Antibody (HRP)

    20-abx309441
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    OR5L1 Antibody (FITC)

    20-abx309442
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    OR5L1 Antibody (Biotin)

    20-abx309443
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    OR5L1 / OR5L2 Antibody

    20-abx322866
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    OR5L1/2 Antibody

    ABD10254 100 ug
    EUR 438

    Anti-OR5L1 antibody

    STJ192869 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to OR5L1

    OR5L1 siRNA

    20-abx927273
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    OR5L1 Antibody, HRP conjugated

    1-CSB-PA839894LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against OR5L1. Recognizes OR5L1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    OR5L1 Antibody, FITC conjugated

    1-CSB-PA839894LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against OR5L1. Recognizes OR5L1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    OR5L1 Antibody, Biotin conjugated

    1-CSB-PA839894LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against OR5L1. Recognizes OR5L1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    OR5L1/2 Conjugated Antibody

    C44613 100ul
    EUR 397

    Anti-OR5L1/2 Antibody

    A16897 100ul
    EUR 397
    Description: Rabbit Polyclonal OR5L1/2 Antibody. Validated in IF and tested in Human.

    Rabbit Olfactory receptor 5L1(OR5L1) ELISA kit

    E04O0642-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Olfactory receptor 5L1(OR5L1) ELISA kit

    E04O0642-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Olfactory receptor 5L1(OR5L1) ELISA kit

    E04O0642-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    OR5L1 cloning plasmid

    CSB-CL839894HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 936
    • Sequence: ATGGGCAAGGAAAACTGCACCACTGTGGCTGAGTTCATTCTCCTTGGACTATCAGATGTCCCTGAGTTGAGAGTCTGCCTCTTCCTGCTGTTCCTTCTCATCTATGGAGTCACGTTGTTAGCCAACCTGGGCATGATTGCACTGATTCAGGTCAGCTCTCGGCTCCACACCCCCAT
    • Show more
    Description: A cloning plasmid for the OR5L1 gene.

    Olfactory Receptor 5L1 (OR5L1) Antibody

    20-abx309440
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    OR5L1/2 Blocking Peptide

    DF10254-BP 1mg
    EUR 195

    Human OR5L1 shRNA Plasmid

    20-abx966379
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    OR5L1 Recombinant Protein (Human)

    RP041920 100 ug Ask for price

    OR5L1 ORF Vector (Human) (pORF)

    ORF013974 1.0 ug DNA
    EUR 354

    OR5L1 sgRNA CRISPR Lentivector set (Human)

    K1523101 3 x 1.0 ug
    EUR 339

    Rat Olfactory receptor 5L1(OR5L1) ELISA kit

    E02O0642-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Olfactory receptor 5L1(OR5L1) ELISA kit

    E02O0642-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Olfactory receptor 5L1(OR5L1) ELISA kit

    E02O0642-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Olfactory receptor 5L1(OR5L1) ELISA kit

    E03O0642-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Olfactory receptor 5L1(OR5L1) ELISA kit

    E03O0642-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Olfactory receptor 5L1(OR5L1) ELISA kit

    E03O0642-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Olfactory receptor 5L1(OR5L1) ELISA kit

    E01O0642-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Olfactory receptor 5L1(OR5L1) ELISA kit

    E01O0642-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Olfactory receptor 5L1(OR5L1) ELISA kit

    E01O0642-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Olfactory receptor 5L1(OR5L1) ELISA kit

    E08O0642-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Olfactory receptor 5L1(OR5L1) ELISA kit

    E08O0642-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Olfactory receptor 5L1(OR5L1) ELISA kit

    E08O0642-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Olfactory receptor 5L1(OR5L1) ELISA kit

    E06O0642-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Olfactory receptor 5L1(OR5L1) ELISA kit

    E06O0642-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Olfactory receptor 5L1(OR5L1) ELISA kit

    E06O0642-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Olfactory receptor 5L1(OR5L1) ELISA kit

    E07O0642-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Olfactory receptor 5L1(OR5L1) ELISA kit

    E07O0642-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Olfactory receptor 5L1(OR5L1) ELISA kit

    E07O0642-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Olfactory receptor 5L1(OR5L1) ELISA kit

    E09O0642-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Olfactory receptor 5L1(OR5L1) ELISA kit

    E09O0642-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Olfactory receptor 5L1(OR5L1) ELISA kit

    E09O0642-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Olfactory receptor 5L1, OR5L1 ELISA KIT

    ELI-14884h 96 Tests
    EUR 824

    OR5L1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1523102 1.0 ug DNA
    EUR 154

    OR5L1 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1523103 1.0 ug DNA
    EUR 154

    OR5L1 sgRNA CRISPR Lentivector (Human) (Target 3)

    K1523104 1.0 ug DNA
    EUR 154

    OR5L1 Protein Vector (Human) (pPB-C-His)

    PV055893 500 ng
    EUR 481

    OR5L1 Protein Vector (Human) (pPB-N-His)

    PV055894 500 ng
    EUR 481

    OR5L1 Protein Vector (Human) (pPM-C-HA)

    PV055895 500 ng
    EUR 481

    OR5L1 Protein Vector (Human) (pPM-C-His)

    PV055896 500 ng
    EUR 481

    OR5L1 3'UTR GFP Stable Cell Line

    TU066658 1.0 ml
    EUR 1394

    OR5L1 3'UTR Luciferase Stable Cell Line

    TU016658 1.0 ml
    EUR 1394

    Guinea pig Olfactory receptor 5L1(OR5L1) ELISA kit

    E05O0642-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Olfactory receptor 5L1(OR5L1) ELISA kit

    E05O0642-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Olfactory receptor 5L1(OR5L1) ELISA kit

    E05O0642-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Olfactory receptor 5L1(OR5L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    GAPDH Rabbit Polyclonal Antibody

    37985-100ul 100ul
    EUR 252

    GAPDH Rabbit Polyclonal Antibody

    37985-50ul 50ul
    EUR 187

    EFHD1 Rabbit Polyclonal Antibody

    38001-100ul 100ul
    EUR 252

    EFHD1 Rabbit Polyclonal Antibody

    38001-50ul 50ul
    EUR 187

    Alliinase Rabbit Polyclonal Antibody

    38042-100ul 100ul
    EUR 252

    Alliinase Rabbit Polyclonal Antibody

    38042-50ul 50ul
    EUR 187

    ECFP Rabbit Polyclonal Antibody

    38077-100ul 100ul
    EUR 252

    ECFP Rabbit Polyclonal Antibody

    38077-50ul 50ul
    EUR 187

    EYFP Rabbit Polyclonal Antibody

    38078-100ul 100ul
    EUR 252

    EYFP Rabbit Polyclonal Antibody

    38078-50ul 50ul
    EUR 187

    mOrange Rabbit Polyclonal Antibody

    38079-100ul 100ul
    EUR 252

    mOrange Rabbit Polyclonal Antibody

    38079-50ul 50ul
    EUR 187

    mStrawberry Rabbit Polyclonal Antibody

    38083-100ul 100ul
    EUR 252

    mStrawberry Rabbit Polyclonal Antibody

    38083-50ul 50ul
    EUR 187

    AmCyan Rabbit Polyclonal Antibody

    38086-100ul 100ul
    EUR 252

    AmCyan Rabbit Polyclonal Antibody

    38086-50ul 50ul
    EUR 187

    EBFP Rabbit Polyclonal Antibody

    38087-100ul 100ul
    EUR 252

    EBFP Rabbit Polyclonal Antibody

    38087-50ul 50ul
    EUR 187

    Vimentin Rabbit Polyclonal Antibody

    38104-100ul 100ul
    EUR 252

    Vimentin Rabbit Polyclonal Antibody

    38104-50ul 50ul
    EUR 187

    LDHD Rabbit Polyclonal Antibody

    38105-100ul 100ul
    EUR 252

    LDHD Rabbit Polyclonal Antibody

    38105-50ul 50ul
    EUR 187

    GAPDH Rabbit Polyclonal Antibody

    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    Rabbit Hemoglobin Polyclonal Antibody

    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Met Rabbit Polyclonal Antibody

    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    OR5L1 Rabbit Polyclonal Antibody