ILF2 Rabbit Polyclonal Antibody

ILF2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    ILF2 Polyclonal Antibody

    ABP58929-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human ILF2 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ILF2 from Human, Mouse, Rat. This ILF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ILF2 protein

    ILF2 Polyclonal Antibody

    ABP58929-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human ILF2 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ILF2 from Human, Mouse, Rat. This ILF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ILF2 protein

    ILF2 Polyclonal Antibody

    ES11916-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ILF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    ILF2 Polyclonal Antibody

    ES11916-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ILF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    ILF2 Rabbit pAb

    A13320-100ul 100 ul
    EUR 308

    ILF2 Rabbit pAb

    A13320-200ul 200 ul
    EUR 459

    ILF2 Rabbit pAb

    A13320-20ul 20 ul
    EUR 183

    ILF2 Rabbit pAb

    A13320-50ul 50 ul
    EUR 223

    ILF2 Rabbit pAb

    A5882-100ul 100 ul
    EUR 308

    ILF2 Rabbit pAb

    A5882-200ul 200 ul
    EUR 459

    ILF2 Rabbit pAb

    A5882-20ul 20 ul
    EUR 183

    ILF2 Rabbit pAb

    A5882-50ul 50 ul
    EUR 223

    ILF2 antibody

    38706-100ul 100ul
    EUR 252

    ILF2 antibody

    10R-3123 100 ug
    EUR 407
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAGEB2 antibody, catalog no. 70R-4320

    ILF2 antibody

    10R-4467 100 ul
    EUR 726
    Description: Mouse monoclonal ILF2 antibody

    ILF2 Antibody

    49780-100ul 100ul
    EUR 333

    ILF2 Antibody

    49780-50ul 50ul
    EUR 239

    ILF2 Antibody

    1-CSB-PA00114A0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ILF2. Recognizes ILF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

    ILF2 Antibody

    1-CSB-PA011683GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against ILF2. Recognizes ILF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

    ILF2 Polyclonal Antibody, Biotin Conjugated

    A52709 100 µg
    EUR 570.55
    Description: reagents widely cited

    ILF2 Polyclonal Antibody, FITC Conjugated

    A52710 100 µg
    EUR 570.55
    Description: Ask the seller for details

    ILF2 Polyclonal Antibody, HRP Conjugated

    A52711 100 µg
    EUR 570.55
    Description: The best epigenetics products

    ILF2 antibody (HRP)

    60R-1363 100 ug
    EUR 327
    Description: Rabbit polyclonal ILF2 antibody (HRP)

    ILF2 antibody (FITC)

    60R-1364 100 ug
    EUR 327
    Description: Rabbit polyclonal ILF2 antibody (FITC)

    ILF2 antibody (biotin)

    60R-1365 100 ug
    EUR 327
    Description: Rabbit polyclonal ILF2 antibody (biotin)

    ILF2 Conjugated Antibody

    C49780 100ul
    EUR 397

    ILF2 Conjugated Antibody

    C38706 100ul
    EUR 397

    ILF2 Antibody (Biotin)

    abx430158-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    Anti-ILF2 antibody

    STJ28155 100 µl
    EUR 277
    Description: The protein encoded by this gene is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The encoded 45 kDa protein (NF45, ILF2) forms a complex with the 90 kDa interleukin enhancer-binding factor 3 (NF90, ILF3), and this complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm, to repair DNA breaks by nonhomologous end joining, and to negatively regulate the microRNA processing pathway. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14.

    Anti-ILF2 antibody

    STJ115284 100 µl
    EUR 277
    Description: The protein encoded by this gene is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The encoded 45 kDa protein (NF45, ILF2) forms a complex with the 90 kDa interleukin enhancer-binding factor 3 (NF90, ILF3), and this complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm, to repair DNA breaks by nonhomologous end joining, and to negatively regulate the microRNA processing pathway. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14.

    Anti-ILF2 antibody

    STJ193074 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to ILF2

    ILF2 siRNA

    20-abx902669
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ILF2 siRNA

    20-abx920556
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ILF2 siRNA

    20-abx920557
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    pOTB7-ILF2

    PVT18443 2 ug
    EUR 231

    anti-ILF2

    YF-PA12726 50 ug
    EUR 363
    Description: Mouse polyclonal to ILF2

    anti-ILF2

    YF-PA12727 100 ul
    EUR 403
    Description: Rabbit polyclonal to ILF2

    anti-ILF2

    YF-PA23991 50 ul
    EUR 334
    Description: Mouse polyclonal to ILF2

    ILF2 Antibody, HRP conjugated

    1-CSB-PA00114B0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ILF2. Recognizes ILF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    ILF2 Antibody, FITC conjugated

    1-CSB-PA00114C0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ILF2. Recognizes ILF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    ILF2 Antibody, Biotin conjugated

    1-CSB-PA00114D0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ILF2. Recognizes ILF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Anti-ILF2 / NF45 antibody

    STJ71178 100 µg
    EUR 359

    ILF2 cloning plasmid

    CSB-CL614262HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1173
    • Sequence: atgaggggtgacagaggccgtggtcgtggtgggcgctttggttccagaggaggcccaggaggagggttcaggccctttgtaccacatatcccatttgacttctatttgtgtgaaatggcctttccccgggtcaagccagcacctgatgaaacttccttcagtgaggccttgctga
    • Show more
    Description: A cloning plasmid for the ILF2 gene.

    pDONR223-ILF2 Plasmid

    PVTB01057-1 2 ug
    EUR 356

    pENTR223-ILF2 vector

    PVT12024 2 ug
    EUR 308

    Anti-ILF2 (1E2)

    YF-MA13805 100 ug
    EUR 363
    Description: Mouse monoclonal to ILF2

    Anti-ILF2 / NF45, Biotinylated antibody

    STJ73229 100 µg
    EUR 359

    ILF2 ELISA KIT|Human

    EF008488 96 Tests
    EUR 689

    Rat ILF2 shRNA Plasmid

    20-abx989608
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse ILF2 shRNA Plasmid

    20-abx976317
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human ILF2 shRNA Plasmid

    20-abx952415
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

    20-abx004512
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

    20-abx110491
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

    20-abx113260
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

    abx031364-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

    abx031364-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

    abx430157-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    Ilf2 ORF Vector (Rat) (pORF)

    ORF068654 1.0 ug DNA
    EUR 506

    ILF2 ORF Vector (Human) (pORF)

    ORF005362 1.0 ug DNA
    EUR 95

    Ilf2 ORF Vector (Mouse) (pORF)

    ORF047903 1.0 ug DNA
    EUR 506

    ILF2 Western Blot kit (AWBK35731)

    AWBK35731 10 reactions
    EUR 647
    Description:
    • Description of target:
    • Species reactivity:
    • Application:
    • Assay info:
    • Sensitivity:

    ILF2 ELISA Kit (Human) (OKEH08335)

    OKEH08335 96 Wells
    EUR 896
    Description: Description of target: The protein encoded by this gene is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The encoded 45 kDa protein (NF45, ILF2) forms a complex with the 90 kDa interleukin enhancer-binding factor 3 (NF90, ILF3), and this complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm, to repair DNA breaks by nonhomologous end joining, and to negatively regulate the microRNA processing pathway. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.085ng/mL

    Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody (Biotin)

    20-abx105027
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody (FITC)

    20-abx106440
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody (HRP)

    20-abx107856
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody Pair

    abx117313-1pair5x96wellplates 1 pair (5x96 well plates)
    EUR 1010
    • Shipped within 5-10 working days.

    Ilf2 sgRNA CRISPR Lentivector set (Mouse)

    K5013101 3 x 1.0 ug
    EUR 339

    Ilf2 sgRNA CRISPR Lentivector set (Rat)

    K6354201 3 x 1.0 ug
    EUR 339

    ILF2 sgRNA CRISPR Lentivector set (Human)

    K1084001 3 x 1.0 ug
    EUR 339

    Human Interleukin enhancer-binding factor 2 (ILF2)

    1-CSB-RP001144h
    • EUR 380.00
    • EUR 214.00
    • EUR 1309.00
    • EUR 560.00
    • EUR 873.00
    • EUR 262.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 70.1 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Interleukin enhancer-binding factor 2(ILF2) expressed in E.coli

    Ilf2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K5013102 1.0 ug DNA
    EUR 154

    Ilf2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K5013103 1.0 ug DNA
    EUR 154

    Ilf2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K5013104 1.0 ug DNA
    EUR 154

    Ilf2 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6354202 1.0 ug DNA
    EUR 154

    Ilf2 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6354203 1.0 ug DNA
    EUR 154

    Ilf2 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6354204 1.0 ug DNA
    EUR 154

    ILF2 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1084002 1.0 ug DNA
    EUR 154

    ILF2 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1084003 1.0 ug DNA
    EUR 154

    ILF2 sgRNA CRISPR Lentivector (Human) (Target 3)

    K1084004 1.0 ug DNA
    EUR 154

    ILF2 Protein Vector (Human) (pPB-C-His)

    PV021445 500 ng
    EUR 329

    ILF2 Protein Vector (Human) (pPB-N-His)

    PV021446 500 ng
    EUR 329

    ILF2 Protein Vector (Human) (pPM-C-HA)

    PV021447 500 ng
    EUR 329

    ILF2 Protein Vector (Human) (pPM-C-His)

    PV021448 500 ng
    EUR 329

    ILF2 Protein Vector (Rat) (pPB-C-His)

    PV274614 500 ng
    EUR 603

    ILF2 Protein Vector (Rat) (pPB-N-His)

    PV274615 500 ng
    EUR 603

    ILF2 Protein Vector (Rat) (pPM-C-HA)

    PV274616 500 ng
    EUR 603

    ILF2 Protein Vector (Rat) (pPM-C-His)

    PV274617 500 ng
    EUR 603

    ILF2 Protein Vector (Mouse) (pPB-C-His)

    PV191610 500 ng
    EUR 603

    ILF2 Protein Vector (Mouse) (pPB-N-His)

    PV191611 500 ng
    EUR 603

    ILF2 Protein Vector (Mouse) (pPM-C-HA)

    PV191612 500 ng
    EUR 603

    ILF2 Protein Vector (Mouse) (pPM-C-His)

    PV191613 500 ng
    EUR 603

    Ilf2 3'UTR Luciferase Stable Cell Line

    TU110092 1.0 ml Ask for price

    Ilf2 3'UTR GFP Stable Cell Line

    TU160092 1.0 ml Ask for price

    Ilf2 3'UTR Luciferase Stable Cell Line

    TU206268 1.0 ml Ask for price

    Ilf2 3'UTR GFP Stable Cell Line

    TU256268 1.0 ml Ask for price

    ILF2 3'UTR GFP Stable Cell Line

    TU061116 1.0 ml
    EUR 4617

    ILF2 3'UTR Luciferase Stable Cell Line

    TU011116 1.0 ml
    EUR 4617

    ILF2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

    LV682225 1.0 ug DNA
    EUR 682

    ILF2 Rabbit Polyclonal Antibody