WFS1 Rabbit Polyclonal Antibody

WFS1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    WFS1 Polyclonal Antibody
    ES11949-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against WFS1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    WFS1 Polyclonal Antibody
    ES11949-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against WFS1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    WFS1 Rabbit pAb
    A1705-100ul 100 ul
    EUR 308
    WFS1 Rabbit pAb
    A1705-200ul 200 ul
    EUR 459
    WFS1 Rabbit pAb
    A1705-20ul 20 ul
    EUR 183
    WFS1 Rabbit pAb
    A1705-50ul 50 ul
    EUR 223
    Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    DLR-WFS1-Hu-48T 48T
    EUR 554
    • Should the Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.
    Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    DLR-WFS1-Hu-96T 96T
    EUR 725
    • Should the Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.
    Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    DLR-WFS1-Mu-48T 48T
    EUR 566
    • Should the Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.
    Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    DLR-WFS1-Mu-96T 96T
    EUR 741
    • Should the Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.
    Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    DLR-WFS1-Ra-48T 48T
    EUR 590
    • Should the Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.
    Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    DLR-WFS1-Ra-96T 96T
    EUR 774
    • Should the Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.
    Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RDR-WFS1-Hu-48Tests 48 Tests
    EUR 589
    Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RDR-WFS1-Hu-96Tests 96 Tests
    EUR 820
    Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RDR-WFS1-Mu-48Tests 48 Tests
    EUR 603
    Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RDR-WFS1-Mu-96Tests 96 Tests
    EUR 840
    Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RDR-WFS1-Ra-48Tests 48 Tests
    EUR 631
    Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RDR-WFS1-Ra-96Tests 96 Tests
    EUR 880
    Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RD-WFS1-Hu-48Tests 48 Tests
    EUR 563
    Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RD-WFS1-Hu-96Tests 96 Tests
    EUR 783
    Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RD-WFS1-Mu-48Tests 48 Tests
    EUR 577
    Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RD-WFS1-Mu-96Tests 96 Tests
    EUR 802
    Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RD-WFS1-Ra-48Tests 48 Tests
    EUR 603
    Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RD-WFS1-Ra-96Tests 96 Tests
    EUR 840
    WFS1 antibody
    70R-21319 50 ul
    EUR 435
    Description: Rabbit polyclonal WFS1 antibody
    WFS1 antibody
    38285-100ul 100ul
    EUR 252
    WFS1 Antibody
    43590-100ul 100ul
    EUR 252
    WFS1 Antibody
    DF6566 200ul
    EUR 304
    Description: WFS1 Antibody detects endogenous levels of total WFS1.
    WFS1 Antibody
    1-CSB-PA026100GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against WFS1. Recognizes WFS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
    WFS1 antibody
    70R-50550 100 ul
    EUR 244
    Description: Purified Polyclonal WFS1 antibody
    WFS1 Antibody
    ABD6566 100 ug
    EUR 438
    Polyclonal WFS1 Antibody (aa183-232)
    APR10738G 0.05ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WFS1 (aa183-232). This antibody is tested and proven to work in the following applications:
    Wolframin (WFS1) Antibody
    20-abx008572
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.
    Wolframin (WFS1) Antibody
    abx036709-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Wolframin (WFS1) Antibody
    abx239509-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    WFS1 Conjugated Antibody
    C43590 100ul
    EUR 397
    Wolframin (WFS1) Antibody
    20-abx001429
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    anti- WFS1 antibody
    FNab09509 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:200-1:2000
    • IHC: 1:50-1:500
    • IF: 1:50-1:200
    • Immunogen: Wolfram syndrome 1(wolframin)
    • Uniprot ID: O76024
    • Gene ID: 7466
    • Research Area: Neuroscience
    Description: Antibody raised against WFS1
    Anti-WFS1 antibody
    PAab09509 100 ug
    EUR 386
    Anti-WFS1 antibody
    STJ26110 100 µl
    EUR 277
    Description: This gene encodes a transmembrane protein, which is located primarily in the endoplasmic reticulum and ubiquitously expressed with highest levels in brain, pancreas, heart, and insulinoma beta-cell lines. Mutations in this gene are associated with Wolfram syndrome, also called DIDMOAD (Diabetes Insipidus, Diabetes Mellitus, Optic Atrophy, and Deafness), an autosomal recessive disorder. The disease affects the brain and central nervous system. Mutations in this gene can also cause autosomal dominant deafness 6 (DFNA6), also known as DFNA14 or DFNA38. Alternatively spliced transcript variants have been found for this gene.
    Anti-WFS1 antibody
    STJ193107 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to WFS1
    WFS1 siRNA
    20-abx939839
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    WFS1 siRNA
    20-abx939840
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    WFS1 Blocking Peptide
    DF6566-BP 1mg
    EUR 195
    WFS1 Blocking Peptide
    20-abx063425
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.
    WFS1 cloning plasmid
    CSB-CL026100HU-10ug 10ug
    EUR 558
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2673
    • Sequence: atggactccaacactgctccgctgggcccctcctgcccacagcccccgccagcaccgcagccccaggcgcgttcccgactcaatgccacagcctcgttggagcaggagaggagcgaaaggccccgagcacccggaccccaggctggccctggccctggtgttagagacgcagcgg
    • Show more
    Description: A cloning plasmid for the WFS1 gene.
    Recombinant human WFS1
    P1940 100ug Ask for price
    • Uniprot ID: O76024
    • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
    Description: Recombinant protein for human WFS1
    Wolfram Syndrome Protein 1 (WFS1) Antibody
    20-abx178933
    • EUR 1316.00
    • EUR 620.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Wolfram Syndrome Protein 1 (WFS1) Antibody
    20-abx178934
    • EUR 1344.00
    • EUR 634.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Wolfram Syndrome Protein 1 (WFS1) Antibody
    20-abx178935
    • EUR 1344.00
    • EUR 634.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Wolfram Syndrome Protein 1 (WFS1) Antibody
    20-abx178936
    • EUR 1414.00
    • EUR 662.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Wolfram Syndrome Protein 1 (WFS1) Antibody
    20-abx175148
    • EUR 926.00
    • EUR 467.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Wolfram Syndrome Protein 1 (WFS1) Antibody
    20-abx175149
    • EUR 982.00
    • EUR 495.00
    • 1 mg
    • 200 ug
    • Please enquire.
    WFS1 ELISA KIT|Human
    EF004293 96 Tests
    EUR 689
    Mouse WFS1 shRNA Plasmid
    20-abx973394
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human WFS1 shRNA Plasmid
    20-abx955107
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human Wolframin, WFS1 ELISA KIT
    ELI-14964h 96 Tests
    EUR 824
    Mouse Wolframin, Wfs1 ELISA KIT
    ELI-40468m 96 Tests
    EUR 865
    Wfs1 ORF Vector (Mouse) (pORF)
    ORF061844 1.0 ug DNA
    EUR 506
    Wfs1 ORF Vector (Rat) (pORF)
    ORF079137 1.0 ug DNA
    EUR 506
    WFS1 ORF Vector (Human) (pORF)
    ORF011595 1.0 ug DNA
    EUR 95
    WFS1 ELISA Kit (Human) (OKCD02035)
    OKCD02035 96 Wells
    EUR 909
    Description: Description of target: Participates in the regulation of cellular Ca2+ homeostasis, at least partly, by modulating the filling state of the endoplasmic reticulum Ca2+ store.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.103 ng/mL
    Wfs1 ELISA Kit (Mouse) (OKCD02036)
    OKCD02036 96 Wells
    EUR 936
    Description: Description of target: Participates in the regulation of cellular Ca2+ homeostasis, at least partly, by modulating the filling state of the endoplasmic reticulum Ca2+ store.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.133 ng/mL
    WFS1 ELISA Kit (Rat) (OKCD09279)
    OKCD09279 96 Wells
    EUR 1157
    Description: Description of target: endoplasmic reticulum membrane glycoprotein; postulated to be involved in neuronal membrane trafficking or protein processing.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.118ng/mL
    Wfs1 sgRNA CRISPR Lentivector set (Mouse)
    K4992301 3 x 1.0 ug
    EUR 339
    ELISA kit for Mouse Wolframin (WFS1)
    KTE70013-48T 48T
    EUR 332
    • Human WHDC1 expressed in insect cells had an apparent molecular mass of about 100 kD by SDS-PAGE. Western blot analysis detected WHDC1 in most human and mouse organs examined, with highest expression in brain. WHDC1 was also expressed in all cultured
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Wolframin (WFS1)
    KTE70013-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Human WHDC1 expressed in insect cells had an apparent molecular mass of about 100 kD by SDS-PAGE. Western blot analysis detected WHDC1 in most human and mouse organs examined, with highest expression in brain. WHDC1 was also expressed in all cultured
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Wolframin (WFS1)
    KTE70013-96T 96T
    EUR 539
    • Human WHDC1 expressed in insect cells had an apparent molecular mass of about 100 kD by SDS-PAGE. Western blot analysis detected WHDC1 in most human and mouse organs examined, with highest expression in brain. WHDC1 was also expressed in all cultured
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Wfs1 sgRNA CRISPR Lentivector set (Rat)
    K6999601 3 x 1.0 ug
    EUR 339
    WFS1 sgRNA CRISPR Lentivector set (Human)
    K2638801 3 x 1.0 ug
    EUR 339
    ELISA kit for Human Wolframin (WFS1)
    KTE60034-48T 48T
    EUR 332
    • Wolframin is a transmembrane protein.Wolframin appears to function as a cation-selective ion channel.Mutations in this gene are associated with an autosomal recessive syndrome characterized by insulin-dependent diabetes mellitus and bilateral progres
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Wolframin (WFS1)
    KTE60034-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Wolframin is a transmembrane protein.Wolframin appears to function as a cation-selective ion channel.Mutations in this gene are associated with an autosomal recessive syndrome characterized by insulin-dependent diabetes mellitus and bilateral progres
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Wolframin (WFS1)
    KTE60034-96T 96T
    EUR 539
    • Wolframin is a transmembrane protein.Wolframin appears to function as a cation-selective ion channel.Mutations in this gene are associated with an autosomal recessive syndrome characterized by insulin-dependent diabetes mellitus and bilateral progres
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Human Wolfram Syndrome Protein 1 (WFS1) Protein
    20-abx655526
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Mouse Wolfram Syndrome Protein 1 (WFS1) Protein
    20-abx655527
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Mouse Wolfram Syndrome Protein 1 (WFS1) Protein
    20-abx655528
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Rat Wolfram Syndrome Protein 1 (WFS1) Protein
    20-abx655529
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Wfs1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4992302 1.0 ug DNA
    EUR 154
    Wfs1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4992303 1.0 ug DNA
    EUR 154
    Wfs1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4992304 1.0 ug DNA
    EUR 154
    Wfs1 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6999602 1.0 ug DNA
    EUR 154
    Wfs1 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6999603 1.0 ug DNA
    EUR 154
    Wfs1 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6999604 1.0 ug DNA
    EUR 154
    WFS1 sgRNA CRISPR Lentivector (Human) (Target 1)
    K2638802 1.0 ug DNA
    EUR 154
    WFS1 sgRNA CRISPR Lentivector (Human) (Target 2)
    K2638803 1.0 ug DNA
    EUR 154
    WFS1 sgRNA CRISPR Lentivector (Human) (Target 3)
    K2638804 1.0 ug DNA
    EUR 154
    WFS1 Protein Vector (Mouse) (pPB-C-His)
    PV247374 500 ng
    EUR 1065
    WFS1 Protein Vector (Mouse) (pPB-N-His)
    PV247375 500 ng
    EUR 1065
    WFS1 Protein Vector (Mouse) (pPM-C-HA)
    PV247376 500 ng
    EUR 1065
    WFS1 Protein Vector (Mouse) (pPM-C-His)
    PV247377 500 ng
    EUR 1065
    WFS1 Protein Vector (Rat) (pPB-C-His)
    PV316546 500 ng
    EUR 1166
    WFS1 Protein Vector (Rat) (pPB-N-His)
    PV316547 500 ng
    EUR 1166
    WFS1 Protein Vector (Rat) (pPM-C-HA)
    PV316548 500 ng
    EUR 1166
    WFS1 Protein Vector (Rat) (pPM-C-His)
    PV316549 500 ng
    EUR 1166
    WFS1 Protein Vector (Human) (pPB-C-His)
    PV046377 500 ng
    EUR 329
    WFS1 Protein Vector (Human) (pPB-N-His)
    PV046378 500 ng
    EUR 329
    WFS1 Protein Vector (Human) (pPM-C-HA)
    PV046379 500 ng
    EUR 329

    WFS1 Rabbit Polyclonal Antibody