RAMP3 Rabbit Polyclonal Antibody

RAMP3 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    RAMP3 Polyclonal Antibody
    ES11934-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against RAMP3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
    RAMP3 Rabbit pAb
    A6715-100ul 100 ul
    EUR 308
    RAMP3 Rabbit pAb
    A6715-200ul 200 ul
    EUR 459
    RAMP3 Rabbit pAb
    A6715-20ul 20 ul
    EUR 183
    RAMP3 Rabbit pAb
    A6715-50ul 50 ul
    EUR 223
    RAMP3 antibody
    70R-19759 50 ul
    EUR 435
    Description: Rabbit polyclonal RAMP3 antibody
    RAMP3 Antibody
    35886-100ul 100ul
    EUR 252
    RAMP3 antibody
    39126-100ul 100ul
    EUR 252
    RAMP3 Antibody
    1-CSB-PA869855
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against RAMP3. Recognizes RAMP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
    RAMP3 Antibody
    1-CSB-PA019306GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against RAMP3. Recognizes RAMP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
    Polyclonal RAMP3 Antibody (C-term)
    AMM07512G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAMP3 (C-term). This antibody is tested and proven to work in the following applications:
    Ramp3/ Rat Ramp3 ELISA Kit
    ELI-30433r 96 Tests
    EUR 886
    RAMP3 Conjugated Antibody
    C35886 100ul
    EUR 397
    anti- RAMP3 antibody
    FNab07099 100µg
    EUR 548.75
    • Immunogen: receptor(G protein-coupled) activity modifying protein 3
    • Uniprot ID: O60896
    • Gene ID: 10268
    • Research Area: Signal Transduction
    Description: Antibody raised against RAMP3
    Anti-RAMP3 antibody
    PAab07099 100 ug
    EUR 386
    Anti-RAMP3 antibody
    STJ28798 100 µl
    EUR 277
    Description: The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP3) protein, CRLR functions as an adrenomedullin receptor.
    Anti-RAMP3 antibody
    STJ193092 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to RAMP3
    RAMP3 siRNA
    20-abx904460
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RAMP3 siRNA
    20-abx930844
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RAMP3 siRNA
    20-abx930845
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    anti-RAMP3
    YF-PA16847 50 ug
    EUR 363
    Description: Mouse polyclonal to RAMP3
    RAMP3 cloning plasmid
    CSB-CL019306HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 447
    • Sequence: atggagactggagcgctgcggcgcccgcaacttctcccgttgctgctgctgctctgcggtgggtgtcccagagcaggcggctgcaacgagacaggcctgttggagaggctgcccctgtgtgggaaggctttcgcagacatgatgggcaaggtggacgtctggaagtggtgcaacct
    • Show more
    Description: A cloning plasmid for the RAMP3 gene.
    RAMP3 cloning plasmid
    CSB-CL019306HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 447
    • Sequence: atggagactggagcgctgcggcgcccgcaacttctcccgttgctgctgctgctctgcggtgggtgtcccagagcaggcggctgcaacgagacaggcatgttggagaggctgcccctgtgtgggaaggctttcgcagacatgatgggcaaggtggacgtctggaagtggtgcaacct
    • Show more
    Description: A cloning plasmid for the RAMP3 gene.
    Anti-RAMP3 (1C11)
    YF-MA17227 100 ug
    EUR 363
    Description: Mouse monoclonal to RAMP3
    Anti-RAMP3 (1B4)
    YF-MA17228 100 ug
    EUR 363
    Description: Mouse monoclonal to RAMP3
    RAMP3 protein (His tag)
    80R-2674 20 ug
    EUR 349
    Description: Purified recombinant RAMP3 protein (His tag)
    RAMP3 ELISA KIT|Human
    EF002303 96 Tests
    EUR 689
    Mouse RAMP3 shRNA Plasmid
    20-abx974620
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Rat RAMP3 shRNA Plasmid
    20-abx985885
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human RAMP3 shRNA Plasmid
    20-abx956951
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    RAMP3 Recombinant Protein (Human)
    RP025720 100 ug Ask for price
    RAMP3 Recombinant Protein (Human)
    RP025723 100 ug Ask for price
    RAMP3 Recombinant Protein (Mouse)
    RP166694 100 ug Ask for price
    RAMP3 Recombinant Protein (Rat)
    RP223559 100 ug Ask for price
    Receptor Activity Modifying Protein 3 (RAMP3) Antibody
    20-abx005152
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Receptor Activity Modifying Protein 3 (RAMP3) Antibody
    20-abx115083
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Receptor Activity Modifying Protein 3 (RAMP3) Antibody
    20-abx241602
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Monoclonal RAMP3 Antibody (monoclonal) (M01), Clone: 1C11
    AMM07513G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human RAMP3 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1C11. This antibody is applicable in WB, E
    Receptor Activity Modifying Protein 3 (RAMP3) Antibody
    abx237099-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    Ramp3 ORF Vector (Rat) (pORF)
    ORF074521 1.0 ug DNA
    EUR 506
    RAMP3 ORF Vector (Human) (pORF)
    ORF008574 1.0 ug DNA
    EUR 95
    RAMP3 ORF Vector (Human) (pORF)
    ORF008575 1.0 ug DNA
    EUR 95
    Ramp3 ORF Vector (Mouse) (pORF)
    ORF055566 1.0 ug DNA
    EUR 506
    Rabbit Anti-Human Receptor Activity Modifying Protein 3 (RAMP3) antiserum #1
    RAMP31-S 100 ul
    EUR 457
    Ramp3 sgRNA CRISPR Lentivector set (Rat)
    K6864301 3 x 1.0 ug
    EUR 339
    RAMP3 sgRNA CRISPR Lentivector set (Human)
    K1783301 3 x 1.0 ug
    EUR 339
    Ramp3 sgRNA CRISPR Lentivector set (Mouse)
    K3660801 3 x 1.0 ug
    EUR 339
    Ramp3 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6864302 1.0 ug DNA
    EUR 154
    Ramp3 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6864303 1.0 ug DNA
    EUR 154
    Ramp3 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6864304 1.0 ug DNA
    EUR 154
    RAMP3 sgRNA CRISPR Lentivector (Human) (Target 1)
    K1783302 1.0 ug DNA
    EUR 154
    RAMP3 sgRNA CRISPR Lentivector (Human) (Target 2)
    K1783303 1.0 ug DNA
    EUR 154
    RAMP3 sgRNA CRISPR Lentivector (Human) (Target 3)
    K1783304 1.0 ug DNA
    EUR 154
    Ramp3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K3660802 1.0 ug DNA
    EUR 154
    Ramp3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K3660803 1.0 ug DNA
    EUR 154
    Ramp3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K3660804 1.0 ug DNA
    EUR 154
    RAMP3 Protein Vector (Rat) (pPB-C-His)
    PV298082 500 ng
    EUR 603
    RAMP3 Protein Vector (Rat) (pPB-N-His)
    PV298083 500 ng
    EUR 603
    RAMP3 Protein Vector (Rat) (pPM-C-HA)
    PV298084 500 ng
    EUR 603
    RAMP3 Protein Vector (Rat) (pPM-C-His)
    PV298085 500 ng
    EUR 603
    RAMP3 Protein Vector (Human) (pPB-C-His)
    PV034293 500 ng
    EUR 329
    RAMP3 Protein Vector (Human) (pPB-N-His)
    PV034294 500 ng
    EUR 329
    RAMP3 Protein Vector (Human) (pPM-C-HA)
    PV034295 500 ng
    EUR 329
    RAMP3 Protein Vector (Human) (pPM-C-His)
    PV034296 500 ng
    EUR 329
    RAMP3 Protein Vector (Human) (pPB-C-His)
    PV034297 500 ng
    EUR 329
    RAMP3 Protein Vector (Human) (pPB-N-His)
    PV034298 500 ng
    EUR 329
    RAMP3 Protein Vector (Human) (pPM-C-HA)
    PV034299 500 ng
    EUR 329
    RAMP3 Protein Vector (Human) (pPM-C-His)
    PV034300 500 ng
    EUR 329
    RAMP3 Protein Vector (Mouse) (pPB-C-His)
    PV222262 500 ng
    EUR 603
    RAMP3 Protein Vector (Mouse) (pPB-N-His)
    PV222263 500 ng
    EUR 603
    RAMP3 Protein Vector (Mouse) (pPM-C-HA)
    PV222264 500 ng
    EUR 603
    RAMP3 Protein Vector (Mouse) (pPM-C-His)
    PV222265 500 ng
    EUR 603
    Recombinant Human RAMP3 Protein, His, E.coli-100ug
    QP13260-100ug 100ug
    EUR 1261
    Recombinant Human RAMP3 Protein, His, E.coli-10ug
    QP13260-10ug 10ug
    EUR 201
    Recombinant Human RAMP3 Protein, His, E.coli-2ug
    QP13260-2ug 2ug
    EUR 155
    Ramp3 3'UTR Luciferase Stable Cell Line
    TU117511 1.0 ml Ask for price
    Ramp3 3'UTR GFP Stable Cell Line
    TU167511 1.0 ml Ask for price
    Ramp3 3'UTR Luciferase Stable Cell Line
    TU217284 1.0 ml Ask for price
    Ramp3 3'UTR GFP Stable Cell Line
    TU267284 1.0 ml Ask for price
    RAMP3 3'UTR GFP Stable Cell Line
    TU069486 1.0 ml
    EUR 1394
    RAMP3 3'UTR Luciferase Stable Cell Line
    TU019486 1.0 ml
    EUR 1394
    Rabbit Anti-Human Receptor Activity Modifying Protein 3 (RAMP3) IgG #1, aff. pure
    RAMP31-A 100 ug
    EUR 482
    RAMP3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
    LV714147 1.0 ug DNA
    EUR 316
    RAMP3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
    LV714151 1.0 ug DNA
    EUR 316
    RAMP3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
    LV714152 1.0 ug DNA
    EUR 316
    RAMP3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
    LV693277 1.0 ug DNA
    EUR 514
    RAMP3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
    LV693281 1.0 ug DNA
    EUR 514
    RAMP3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
    LV693282 1.0 ug DNA
    EUR 514
    GAPDH Rabbit Polyclonal Antibody
    37985-100ul 100ul
    EUR 252
    GAPDH Rabbit Polyclonal Antibody
    37985-50ul 50ul
    EUR 187
    EFHD1 Rabbit Polyclonal Antibody
    38001-100ul 100ul
    EUR 252
    EFHD1 Rabbit Polyclonal Antibody
    38001-50ul 50ul
    EUR 187
    Alliinase Rabbit Polyclonal Antibody
    38042-100ul 100ul
    EUR 252
    Alliinase Rabbit Polyclonal Antibody
    38042-50ul 50ul
    EUR 187
    ECFP Rabbit Polyclonal Antibody
    38077-100ul 100ul
    EUR 252
    ECFP Rabbit Polyclonal Antibody
    38077-50ul 50ul
    EUR 187

    RAMP3 Rabbit Polyclonal Antibody