NPSR1 Rabbit Polyclonal Antibody

NPSR1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

NPSR1 Polyclonal Antibody
29918-100ul 100ul
EUR 252
NPSR1 Polyclonal Antibody
29918-50ul 50ul
EUR 187
NPSR1 Polyclonal Antibody
29919-100ul 100ul
EUR 252
NPSR1 Polyclonal Antibody
29919-50ul 50ul
EUR 187
NPSR1 Rabbit pAb
A16618-100ul 100 ul
EUR 308
NPSR1 Rabbit pAb
A16618-200ul 200 ul
EUR 459
NPSR1 Rabbit pAb
A16618-20ul 20 ul
EUR 183
NPSR1 Rabbit pAb
A16618-50ul 50 ul
EUR 223
NPSR1 Rabbit pAb
A16619-100ul 100 ul
EUR 308
NPSR1 Rabbit pAb
A16619-200ul 200 ul
EUR 459
NPSR1 Rabbit pAb
A16619-20ul 20 ul
EUR 183
NPSR1 Rabbit pAb
A16619-50ul 50 ul
EUR 223
NPSR1 Polyclonal Conjugated Antibody
C29918 100ul
EUR 397
NPSR1 Polyclonal Conjugated Antibody
C29919 100ul
EUR 397
NPSR1 Antibody
ABD2822 100 ug
EUR 438
NPSR1 Antibody
39424-100ul 100ul
EUR 390
NPSR1 Antibody
DF2822 200ul
EUR 304
Description: NPSR1 antibody detects endogenous levels of total NPSR1.
NPSR1 Antibody
1-CSB-PA757818LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NPSR1. Recognizes NPSR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200
Npsr1/ Rat Npsr1 ELISA Kit
ELI-23684r 96 Tests
EUR 886
Anti-NPSR1 antibody
STJ119056 100 µl
EUR 277
Anti-NPSR1 antibody
STJ119057 100 µl
EUR 277
Anti-NPSR1 antibody
STJ192667 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NPSR1
NPSR1 siRNA
20-abx926283
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NPSR1 siRNA
20-abx926284
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-NPSR1
YF-PA27050 50 ul
EUR 334
Description: Mouse polyclonal to NPSR1
Polyclonal NPSR1 / NPSR / GPR154 Antibody (Extracellular Domain)
AMM06796G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NPSR1 / NPSR / GPR154 (Extracellular Domain). This antibody is tested and proven to work in the following applications:
NPSR1 Antibody, HRP conjugated
1-CSB-PA757818LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NPSR1. Recognizes NPSR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
NPSR1 Antibody, FITC conjugated
1-CSB-PA757818LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NPSR1. Recognizes NPSR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
NPSR1 Antibody, Biotin conjugated
1-CSB-PA757818LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NPSR1. Recognizes NPSR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
NPSR1 Blocking Peptide
DF2822-BP 1mg
EUR 195
NPSR1 cloning plasmid
CSB-CL757818HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atgccagccaacttcacagagggcagcttcgattccagtgggaccgggcagacgctggattcttccccagtggcttgcactgaaacagtgacttttactgaagtggtggaaggaaaggaatggggttccttctactactcctttaagactgagcaattgataactctgtgggtcc
  • Show more
Description: A cloning plasmid for the NPSR1 gene.
Anti-NPSR1 (2F5)
YF-MA20144 100 ug
EUR 363
Description: Mouse monoclonal to NPSR1
Neuropeptide S Receptor (NPSR1) Antibody
abx037670-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Neuropeptide S Receptor (NPSR1) Antibody
abx037671-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Neuropeptide S Receptor (NPSR1) Antibody
abx038292-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Neuropeptide S Receptor (NPSR1) Antibody
20-abx318774
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mouse NPSR1 shRNA Plasmid
20-abx983259
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
NPSR1 ELISA KIT|Human
EF005346 96 Tests
EUR 689
Human NPSR1 shRNA Plasmid
20-abx967728
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
NPSR1 Recombinant Protein (Human)
RP041731 100 ug Ask for price
NPSR1 Recombinant Protein (Rat)
RP214385 100 ug Ask for price
NPSR1 Recombinant Protein (Mouse)
RP154781 100 ug Ask for price
Neuropeptide S Receptor (NPSR1) Antibody (HRP)
20-abx317465
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Neuropeptide S Receptor (NPSR1) Antibody (FITC)
20-abx317466
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Neuropeptide S Receptor (NPSR1) Antibody (Biotin)
20-abx317467
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Npsr1 ORF Vector (Rat) (pORF)
ORF071463 1.0 ug DNA
EUR 506
NPSR1 ORF Vector (Human) (pORF)
ORF013911 1.0 ug DNA
EUR 354
Npsr1 ORF Vector (Mouse) (pORF)
ORF051595 1.0 ug DNA
EUR 506
NPSR1 sgRNA CRISPR Lentivector set (Human)
K1449801 3 x 1.0 ug
EUR 339
Npsr1 sgRNA CRISPR Lentivector set (Mouse)
K3616501 3 x 1.0 ug
EUR 339
Npsr1 sgRNA CRISPR Lentivector set (Rat)
K6707801 3 x 1.0 ug
EUR 339
NPSR1-AS1 ORF Vector (Human) (pORF)
ORF026238 1.0 ug DNA Ask for price
Mouse Neuropeptide S receptor, Npsr1 ELISA KIT
ELI-22107m 96 Tests
EUR 865
Human Neuropeptide S receptor, NPSR1 ELISA KIT
ELI-14847h 96 Tests
EUR 824
Human Neuropeptide S receptor (NPSR1) ELISA Kit
abx385215-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Neuropeptide S receptor (NPSR1) ELISA Kit
abx390034-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Neuropeptide S receptor (NPSR1) ELISA Kit
abx391701-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
NPSR1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1449802 1.0 ug DNA
EUR 154
NPSR1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1449803 1.0 ug DNA
EUR 154
NPSR1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1449804 1.0 ug DNA
EUR 154
Npsr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3616502 1.0 ug DNA
EUR 154
Npsr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3616503 1.0 ug DNA
EUR 154
Npsr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3616504 1.0 ug DNA
EUR 154
Human Neuropeptide S receptor(NPSR1) ELISA kit
CSB-EL016027HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neuropeptide S receptor (NPSR1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Neuropeptide S receptor(NPSR1) ELISA kit
1-CSB-EL016027HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neuropeptide S receptor(NPSR1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Npsr1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6707802 1.0 ug DNA
EUR 154
Npsr1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6707803 1.0 ug DNA
EUR 154
Npsr1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6707804 1.0 ug DNA
EUR 154
NPSR1 Protein Vector (Human) (pPB-C-His)
PV055641 500 ng
EUR 481
NPSR1 Protein Vector (Human) (pPB-N-His)
PV055642 500 ng
EUR 481
NPSR1 Protein Vector (Human) (pPM-C-HA)
PV055643 500 ng
EUR 481
NPSR1 Protein Vector (Human) (pPM-C-His)
PV055644 500 ng
EUR 481
NPSR1 Protein Vector (Mouse) (pPB-C-His)
PV206378 500 ng
EUR 603
NPSR1 Protein Vector (Mouse) (pPB-N-His)
PV206379 500 ng
EUR 603
NPSR1 Protein Vector (Mouse) (pPM-C-HA)
PV206380 500 ng
EUR 603
NPSR1 Protein Vector (Mouse) (pPM-C-His)
PV206381 500 ng
EUR 603
NPSR1 Protein Vector (Rat) (pPB-C-His)
PV285850 500 ng
EUR 603
NPSR1 Protein Vector (Rat) (pPB-N-His)
PV285851 500 ng
EUR 603
NPSR1 Protein Vector (Rat) (pPM-C-HA)
PV285852 500 ng
EUR 603
NPSR1 Protein Vector (Rat) (pPM-C-His)
PV285853 500 ng
EUR 603
Npsr1 3'UTR GFP Stable Cell Line
TU164270 1.0 ml Ask for price
NPSR1 3'UTR Luciferase Stable Cell Line
TU015916 1.0 ml
EUR 1394
Npsr1 3'UTR Luciferase Stable Cell Line
TU114270 1.0 ml Ask for price
NPSR1 3'UTR GFP Stable Cell Line
TU065916 1.0 ml
EUR 1394
Npsr1 3'UTR GFP Stable Cell Line
TU264141 1.0 ml Ask for price
Npsr1 3'UTR Luciferase Stable Cell Line
TU214141 1.0 ml Ask for price
NPSR1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV696979 1.0 ug DNA
EUR 682
NPSR1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV696983 1.0 ug DNA
EUR 682
NPSR1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV696984 1.0 ug DNA
EUR 682
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NPSR1 Rabbit Polyclonal Antibody