NPSR1 Rabbit Polyclonal Antibody

NPSR1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    NPSR1 Polyclonal Antibody
    29918-100ul 100ul
    EUR 252
    NPSR1 Polyclonal Antibody
    29918-50ul 50ul
    EUR 187
    NPSR1 Polyclonal Antibody
    29919-100ul 100ul
    EUR 252
    NPSR1 Polyclonal Antibody
    29919-50ul 50ul
    EUR 187
    NPSR1 Rabbit pAb
    A16618-100ul 100 ul
    EUR 308
    NPSR1 Rabbit pAb
    A16618-200ul 200 ul
    EUR 459
    NPSR1 Rabbit pAb
    A16618-20ul 20 ul
    EUR 183
    NPSR1 Rabbit pAb
    A16618-50ul 50 ul
    EUR 223
    NPSR1 Rabbit pAb
    A16619-100ul 100 ul
    EUR 308
    NPSR1 Rabbit pAb
    A16619-200ul 200 ul
    EUR 459
    NPSR1 Rabbit pAb
    A16619-20ul 20 ul
    EUR 183
    NPSR1 Rabbit pAb
    A16619-50ul 50 ul
    EUR 223
    NPSR1 Polyclonal Conjugated Antibody
    C29918 100ul
    EUR 397
    NPSR1 Polyclonal Conjugated Antibody
    C29919 100ul
    EUR 397
    NPSR1 Antibody
    ABD2822 100 ug
    EUR 438
    NPSR1 Antibody
    39424-100ul 100ul
    EUR 390
    NPSR1 Antibody
    DF2822 200ul
    EUR 304
    Description: NPSR1 antibody detects endogenous levels of total NPSR1.
    NPSR1 Antibody
    1-CSB-PA757818LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NPSR1. Recognizes NPSR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200
    Npsr1/ Rat Npsr1 ELISA Kit
    ELI-23684r 96 Tests
    EUR 886
    Anti-NPSR1 antibody
    STJ119056 100 µl
    EUR 277
    Anti-NPSR1 antibody
    STJ119057 100 µl
    EUR 277
    Anti-NPSR1 antibody
    STJ192667 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to NPSR1
    NPSR1 siRNA
    20-abx926283
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    NPSR1 siRNA
    20-abx926284
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    anti-NPSR1
    YF-PA27050 50 ul
    EUR 334
    Description: Mouse polyclonal to NPSR1
    Polyclonal NPSR1 / NPSR / GPR154 Antibody (Extracellular Domain)
    AMM06796G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NPSR1 / NPSR / GPR154 (Extracellular Domain). This antibody is tested and proven to work in the following applications:
    NPSR1 Antibody, HRP conjugated
    1-CSB-PA757818LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NPSR1. Recognizes NPSR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    NPSR1 Antibody, FITC conjugated
    1-CSB-PA757818LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NPSR1. Recognizes NPSR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    NPSR1 Antibody, Biotin conjugated
    1-CSB-PA757818LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against NPSR1. Recognizes NPSR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    NPSR1 Blocking Peptide
    DF2822-BP 1mg
    EUR 195
    NPSR1 cloning plasmid
    CSB-CL757818HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1134
    • Sequence: atgccagccaacttcacagagggcagcttcgattccagtgggaccgggcagacgctggattcttccccagtggcttgcactgaaacagtgacttttactgaagtggtggaaggaaaggaatggggttccttctactactcctttaagactgagcaattgataactctgtgggtcc
    • Show more
    Description: A cloning plasmid for the NPSR1 gene.
    Anti-NPSR1 (2F5)
    YF-MA20144 100 ug
    EUR 363
    Description: Mouse monoclonal to NPSR1
    Neuropeptide S Receptor (NPSR1) Antibody
    abx037670-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Neuropeptide S Receptor (NPSR1) Antibody
    abx037671-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Neuropeptide S Receptor (NPSR1) Antibody
    abx038292-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Neuropeptide S Receptor (NPSR1) Antibody
    20-abx318774
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Mouse NPSR1 shRNA Plasmid
    20-abx983259
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    NPSR1 ELISA KIT|Human
    EF005346 96 Tests
    EUR 689
    Human NPSR1 shRNA Plasmid
    20-abx967728
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    NPSR1 Recombinant Protein (Human)
    RP041731 100 ug Ask for price
    NPSR1 Recombinant Protein (Rat)
    RP214385 100 ug Ask for price
    NPSR1 Recombinant Protein (Mouse)
    RP154781 100 ug Ask for price
    Neuropeptide S Receptor (NPSR1) Antibody (HRP)
    20-abx317465
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Neuropeptide S Receptor (NPSR1) Antibody (FITC)
    20-abx317466
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Neuropeptide S Receptor (NPSR1) Antibody (Biotin)
    20-abx317467
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Npsr1 ORF Vector (Rat) (pORF)
    ORF071463 1.0 ug DNA
    EUR 506
    NPSR1 ORF Vector (Human) (pORF)
    ORF013911 1.0 ug DNA
    EUR 354
    Npsr1 ORF Vector (Mouse) (pORF)
    ORF051595 1.0 ug DNA
    EUR 506
    NPSR1 sgRNA CRISPR Lentivector set (Human)
    K1449801 3 x 1.0 ug
    EUR 339
    Npsr1 sgRNA CRISPR Lentivector set (Mouse)
    K3616501 3 x 1.0 ug
    EUR 339
    Npsr1 sgRNA CRISPR Lentivector set (Rat)
    K6707801 3 x 1.0 ug
    EUR 339
    NPSR1-AS1 ORF Vector (Human) (pORF)
    ORF026238 1.0 ug DNA Ask for price
    Mouse Neuropeptide S receptor, Npsr1 ELISA KIT
    ELI-22107m 96 Tests
    EUR 865
    Human Neuropeptide S receptor, NPSR1 ELISA KIT
    ELI-14847h 96 Tests
    EUR 824
    Human Neuropeptide S receptor (NPSR1) ELISA Kit
    abx385215-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Mouse Neuropeptide S receptor (NPSR1) ELISA Kit
    abx390034-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Rat Neuropeptide S receptor (NPSR1) ELISA Kit
    abx391701-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    NPSR1 sgRNA CRISPR Lentivector (Human) (Target 1)
    K1449802 1.0 ug DNA
    EUR 154
    NPSR1 sgRNA CRISPR Lentivector (Human) (Target 2)
    K1449803 1.0 ug DNA
    EUR 154
    NPSR1 sgRNA CRISPR Lentivector (Human) (Target 3)
    K1449804 1.0 ug DNA
    EUR 154
    Npsr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K3616502 1.0 ug DNA
    EUR 154
    Npsr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K3616503 1.0 ug DNA
    EUR 154
    Npsr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K3616504 1.0 ug DNA
    EUR 154
    Human Neuropeptide S receptor(NPSR1) ELISA kit
    CSB-EL016027HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Neuropeptide S receptor (NPSR1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Neuropeptide S receptor(NPSR1) ELISA kit
    1-CSB-EL016027HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Neuropeptide S receptor(NPSR1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Npsr1 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6707802 1.0 ug DNA
    EUR 154
    Npsr1 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6707803 1.0 ug DNA
    EUR 154
    Npsr1 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6707804 1.0 ug DNA
    EUR 154
    NPSR1 Protein Vector (Human) (pPB-C-His)
    PV055641 500 ng
    EUR 481
    NPSR1 Protein Vector (Human) (pPB-N-His)
    PV055642 500 ng
    EUR 481
    NPSR1 Protein Vector (Human) (pPM-C-HA)
    PV055643 500 ng
    EUR 481
    NPSR1 Protein Vector (Human) (pPM-C-His)
    PV055644 500 ng
    EUR 481
    NPSR1 Protein Vector (Mouse) (pPB-C-His)
    PV206378 500 ng
    EUR 603
    NPSR1 Protein Vector (Mouse) (pPB-N-His)
    PV206379 500 ng
    EUR 603
    NPSR1 Protein Vector (Mouse) (pPM-C-HA)
    PV206380 500 ng
    EUR 603
    NPSR1 Protein Vector (Mouse) (pPM-C-His)
    PV206381 500 ng
    EUR 603
    NPSR1 Protein Vector (Rat) (pPB-C-His)
    PV285850 500 ng
    EUR 603
    NPSR1 Protein Vector (Rat) (pPB-N-His)
    PV285851 500 ng
    EUR 603
    NPSR1 Protein Vector (Rat) (pPM-C-HA)
    PV285852 500 ng
    EUR 603
    NPSR1 Protein Vector (Rat) (pPM-C-His)
    PV285853 500 ng
    EUR 603
    Npsr1 3'UTR GFP Stable Cell Line
    TU164270 1.0 ml Ask for price
    NPSR1 3'UTR Luciferase Stable Cell Line
    TU015916 1.0 ml
    EUR 1394
    Npsr1 3'UTR Luciferase Stable Cell Line
    TU114270 1.0 ml Ask for price
    NPSR1 3'UTR GFP Stable Cell Line
    TU065916 1.0 ml
    EUR 1394
    Npsr1 3'UTR GFP Stable Cell Line
    TU264141 1.0 ml Ask for price
    Npsr1 3'UTR Luciferase Stable Cell Line
    TU214141 1.0 ml Ask for price
    NPSR1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
    LV696979 1.0 ug DNA
    EUR 682
    NPSR1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
    LV696983 1.0 ug DNA
    EUR 682
    NPSR1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
    LV696984 1.0 ug DNA
    EUR 682
    VEGF Rabbit Polyclonal Antibody
    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    VEGF Rabbit Polyclonal Antibody
    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    CD10 Rabbit Polyclonal Antibody
    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    CD10 Rabbit Polyclonal Antibody
    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NM23A Rabbit Polyclonal Antibody
    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NM23A Rabbit Polyclonal Antibody
    ES8455-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8456-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8456-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8457-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8457-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    HSC70 Rabbit Polyclonal Antibody
    ES8558-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSC70 Rabbit Polyclonal Antibody
    ES8558-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSP40 Rabbit Polyclonal Antibody
    ES8559-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSP40 Rabbit Polyclonal Antibody
    ES8559-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSP90? Rabbit Polyclonal Antibody
    ES8560-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    HSP90? Rabbit Polyclonal Antibody
    ES8560-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    IkB ? Rabbit Polyclonal Antibody
    ES8561-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    IkB ? Rabbit Polyclonal Antibody
    ES8561-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    JAK1 Rabbit Polyclonal Antibody
    ES8562-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    JAK1 Rabbit Polyclonal Antibody
    ES8562-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    JAK2 Rabbit Polyclonal Antibody
    ES8563-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NPSR1 Rabbit Polyclonal Antibody