MCHR1 Rabbit Polyclonal Antibody

MCHR1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

MCHR1 Polyclonal Antibody

ABP59238-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MCHR1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MCHR1 from Human, Mouse, Rat. This MCHR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCHR1 protein

MCHR1 Polyclonal Antibody

ABP59238-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MCHR1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MCHR1 from Human, Mouse, Rat. This MCHR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCHR1 protein

MCHR1 Rabbit pAb

A18111-100ul 100 ul
EUR 308

MCHR1 Rabbit pAb

A18111-200ul 200 ul
EUR 459

MCHR1 Rabbit pAb

A18111-20ul 20 ul
EUR 183

MCHR1 Rabbit pAb

A18111-50ul 50 ul
EUR 223

Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit

DLR-MCHR1-Hu-48T 48T
EUR 517
  • Should the Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Melanin Concentrating Hormone Receptor 1 (MCHR1) in samples from tissue homogenates or other biological fluids.

Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit

DLR-MCHR1-Hu-96T 96T
EUR 673
  • Should the Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Melanin Concentrating Hormone Receptor 1 (MCHR1) in samples from tissue homogenates or other biological fluids.

Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit

RD-MCHR1-Hu-48Tests 48 Tests
EUR 521

Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit

RD-MCHR1-Hu-96Tests 96 Tests
EUR 723

Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit

RDR-MCHR1-Hu-48Tests 48 Tests
EUR 544

Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit

RDR-MCHR1-Hu-96Tests 96 Tests
EUR 756

MCHR1 Antibody

ABD2819 100 ug
EUR 438

MCHR1 Antibody

37720-100ul 100ul
EUR 252

MCHR1 antibody

70R-18438 50 ul
EUR 435
Description: Rabbit polyclonal MCHR1 antibody

MCHR1 Antibody

1-CSB-PA998557
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

MCHR1 Antibody

DF2819 200ul
EUR 304
Description: MCHR1 antibody detects endogenous levels of total MCHR1.

MCHR1 Antibody

1-CSB-PA013584GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MCHR1 Antibody

1-CSB-PA132314
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

Polyclonal MCHR1 Antibody (N-Terminus)

APC00068G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal MCHR1 Antibody (C-Terminus)

APS00038G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal MCHR1 Antibody (C-term)

APR12512G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal MCHR1 Antibody (N-Terminus)

APR12513G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (N-Terminus). This antibody is tested and proven to work in the following applications:

MCHR1 Conjugated Antibody

C37720 100ul
EUR 397

anti- MCHR1 antibody

FNab05050 100µg
EUR 585
  • Immunogen: melanin-concentrating hormone receptor 1
  • Uniprot ID: Q99705
  • Gene ID: 2847
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against MCHR1

anti- MCHR1 antibody

FNab05051 100µg
EUR 505.25
  • Immunogen: melanin-concentrating hormone receptor 1
  • Uniprot ID: Q99705
  • Gene ID: 2847
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against MCHR1

Anti-MCHR1 antibody

PAab05050 100 ug
EUR 412

Anti-MCHR1 antibody

PAab05051 100 ug
EUR 355

Anti-MCHR1 antibody

STJ11100082 100 µl
EUR 277

Anti-MCHR1 antibody

STJ192665 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MCHR1

Mchr1/ Rat Mchr1 ELISA Kit

ELI-03776r 96 Tests
EUR 886

MCHR1 siRNA

20-abx903189
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MCHR1 siRNA

20-abx923721
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MCHR1 siRNA

20-abx923722
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MCHR1 cloning plasmid

CSB-CL013584HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1269
  • Sequence: atgtcagtgggagccatgaagaagggagtggggagggcagttgggcttggaggcggcagcggctgccaggctacggaggaagacccccttcccgactgcggggcttgcgctccgggacaaggtggcaggcgctggaggctgccgcagcctgcgtgggtggaggggagctcagctc
  • Show more
Description: A cloning plasmid for the MCHR1 gene.

MCHr1 antagonist 2

HY-100321 1mg
EUR 696

MCHr1 antagonist 1

HY-U00353 1mg
EUR 1813

MCHR1 Blocking Peptide

DF2819-BP 1mg
EUR 195

Mouse MCHR1 shRNA Plasmid

20-abx980518
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat MCHR1 shRNA Plasmid

20-abx986797
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MCHR1 ELISA Kit

ELA-E1146h 96 Tests
EUR 824

MCHR1 ELISA KIT|Human

EF003698 96 Tests
EUR 689

Human MCHR1 shRNA Plasmid

20-abx951910
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MCHR1 Recombinant Protein (Human)

RP018973 100 ug Ask for price

MCHR1 Recombinant Protein (Rat)

RP211109 100 ug Ask for price

MCHR1 Recombinant Protein (Mouse)

RP149813 100 ug Ask for price

Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit

E04M0388-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit

E04M0388-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit

E04M0388-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

20-abx113654
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

abx025849-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

abx025849-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

20-abx173523
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

20-abx177519
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

20-abx242224
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

20-abx242225
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

abx235050-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody

abx235051-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

MCHR1 ORF Vector (Human) (pORF)

ORF006325 1.0 ug DNA
EUR 95

Mchr1 ORF Vector (Mouse) (pORF)

ORF049939 1.0 ug DNA
EUR 506

Mchr1 ORF Vector (Rat) (pORF)

ORF070371 1.0 ug DNA
EUR 506

MCHR1 sgRNA CRISPR Lentivector set (Human)

K1279601 3 x 1.0 ug
EUR 339

Mchr1 sgRNA CRISPR Lentivector set (Mouse)

K3647501 3 x 1.0 ug
EUR 339

Mchr1 sgRNA CRISPR Lentivector set (Rat)

K6945101 3 x 1.0 ug
EUR 339

MCHR1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1279602 1.0 ug DNA
EUR 154

MCHR1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1279603 1.0 ug DNA
EUR 154

MCHR1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1279604 1.0 ug DNA
EUR 154

Mchr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3647502 1.0 ug DNA
EUR 154

Mchr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3647503 1.0 ug DNA
EUR 154

Mchr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3647504 1.0 ug DNA
EUR 154

Mchr1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6945102 1.0 ug DNA
EUR 154

Mchr1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6945103 1.0 ug DNA
EUR 154

Mchr1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6945104 1.0 ug DNA
EUR 154

MCHR1 Protein Vector (Rat) (pPB-C-His)

PV281482 500 ng
EUR 603

MCHR1 Protein Vector (Rat) (pPB-N-His)

PV281483 500 ng
EUR 603

MCHR1 Protein Vector (Rat) (pPM-C-HA)

PV281484 500 ng
EUR 603

MCHR1 Protein Vector (Rat) (pPM-C-His)

PV281485 500 ng
EUR 603

MCHR1 Protein Vector (Human) (pPB-C-His)

PV025297 500 ng
EUR 329

MCHR1 Protein Vector (Human) (pPB-N-His)

PV025298 500 ng
EUR 329

MCHR1 Protein Vector (Human) (pPM-C-HA)

PV025299 500 ng
EUR 329

MCHR1 Protein Vector (Human) (pPM-C-His)

PV025300 500 ng
EUR 329

MCHR1 Protein Vector (Mouse) (pPB-C-His)

PV199754 500 ng
EUR 603

MCHR1 Protein Vector (Mouse) (pPB-N-His)

PV199755 500 ng
EUR 603

MCHR1 Protein Vector (Mouse) (pPM-C-HA)

PV199756 500 ng
EUR 603

MCHR1 Protein Vector (Mouse) (pPM-C-His)

PV199757 500 ng
EUR 603

Mchr1 3'UTR GFP Stable Cell Line

TU162992 1.0 ml Ask for price

Mchr1 3'UTR Luciferase Stable Cell Line

TU212958 1.0 ml Ask for price

MCHR1 3'UTR Luciferase Stable Cell Line

TU013116 1.0 ml
EUR 1394

Mchr1 3'UTR Luciferase Stable Cell Line

TU112992 1.0 ml Ask for price

MCHR1 3'UTR GFP Stable Cell Line

TU063116 1.0 ml
EUR 1394

Mchr1 3'UTR GFP Stable Cell Line

TU262958 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MCHR1 Rabbit Polyclonal Antibody