LGR5 Rabbit Polyclonal Antibody

LGR5 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    LGR5 Polyclonal Antibody
    ABP59113-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human LGR5 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of LGR5 from Human, Mouse. This LGR5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LGR5 protein
    LGR5 Polyclonal Antibody
    ABP59113-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human LGR5 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of LGR5 from Human, Mouse. This LGR5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LGR5 protein
    LGR5 Rabbit pAb
    A10545-100ul 100 ul
    EUR 308
    LGR5 Rabbit pAb
    A10545-200ul 200 ul
    EUR 459
    LGR5 Rabbit pAb
    A10545-20ul 20 ul
    EUR 183
    LGR5 Rabbit pAb
    A10545-50ul 50 ul
    EUR 223
    LGR5 Rabbit pAb
    A19489-100ul 100 ul Ask for price
    LGR5 Rabbit pAb
    A19489-200ul 200 ul Ask for price
    LGR5 Rabbit pAb
    A19489-20ul 20 ul Ask for price
    LGR5 Rabbit pAb
    A19489-50ul 50 ul
    EUR 308
    Polyclonal LGR5 Antibody (loop2)
    APR05065G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGR5 (loop2). This antibody is tested and proven to work in the following applications:
    LGR5/GPR49 Rabbit mAb
    A12327-100ul 100 ul
    EUR 410
    LGR5/GPR49 Rabbit mAb
    A12327-200ul 200 ul
    EUR 571
    LGR5/GPR49 Rabbit mAb
    A12327-20ul 20 ul
    EUR 221
    LGR5/GPR49 Rabbit mAb
    A12327-50ul 50 ul
    EUR 287
    LGR5 Antibody
    AF7530 200ul
    EUR 376
    Description: LGR5 Antibody detects endogenous levels of LGR5.
    LGR5 Antibody
    A1007-100
    EUR 354
    LGR5 Antibody
    ABD2816 100 ug
    EUR 438
    LGR5 Antibody
    44974-100ul 100ul
    EUR 252
    LGR5 Antibody
    44974-50ul 50ul
    EUR 187
    LGR5 antibody
    20R-2773 50 ug
    EUR 281
    Description: Rabbit polyclonal LGR5 antibody
    LGR5 Antibody
    DF2816 200ul
    EUR 304
    Description: LGR5 antibody detects endogenous levels of total LGR5.
    LGR5 Antibody
    1-CSB-PA012906LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200
    LGR5 Antibody
    CSB-PA622827-
    EUR 335
    • Form: liquid
    • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
    • Show more
    Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
    LGR5 Antibody
    CSB-PA622827-100ul 100ul
    EUR 316
    • Form: liquid
    • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
    • Show more
    Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
    LGR5 Antibody
    1-CSB-PA080695
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100
    Polyclonal LGR5 (GPR49) Antibody (loop1)
    APR05064G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGR5 (GPR49) (loop1). This antibody is tested and proven to work in the following applications:
    Polyclonal LGR5 (GPR49) Antibody (Center)
    APR05066G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGR5 (GPR49) (Center). This antibody is tested and proven to work in the following applications:
    Anti-LGR5/GPR49 Rabbit Monoclonal Antibody
    M00239 100ug/vial
    EUR 397
    Description: Rabbit Monoclonal LGR5/GPR49 Antibody. Validated in Flow Cytometry, IP, WB and tested in Human, Mouse, Rat.
    Polyclonal GPR49 / LGR5 Antibody (N-Terminus)
    APR01956G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR49 / LGR5 (N-Terminus). This antibody is tested and proven to work in the following applications:
    Polyclonal GPR49 / LGR5 Antibody (Cytoplasmic Domain)
    APR01957G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR49 / LGR5 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
    Polyclonal GPR49 / LGR5 Antibody (Cytoplasmic Domain)
    APR01958G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR49 / LGR5 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
    LGR5(GPR49) Antibody
    AF4102 200ul
    EUR 376
    Description: The antibody detects endogenous level of total LGR5(GPR49) protein.
    LGR5 Conjugated Antibody
    C44974 100ul
    EUR 397
    anti- LGR5 antibody
    FNab04765 100µg
    EUR 585
    • Recommended dilution: IHC: 1:100-1:400
    • Immunogen: leucine-rich repeat-containing G protein-coupled receptor 5
    • Uniprot ID: O75473
    • Gene ID: 8549
    • Research Area: Signal Transduction
    Description: Antibody raised against LGR5
    LGR5 / GPR49 Antibody
    abx031681-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    LGR5 / GPR49 Antibody
    abx031681-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    LGR5 (loop2) Antibody
    abx031683-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    LGR5 (loop2) Antibody
    abx031683-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    LGR5 (GPR49) Antibody
    abx020041-100ug 100 ug
    EUR 439
    • Shipped within 5-10 working days.
    LGR5 (GPR49) Antibody
    ABF4102 100 ug
    EUR 438
    LGR5/GPR49 Antibody
    48810-100ul 100ul
    EUR 333
    LGR5/GPR49 Antibody
    48810-50ul 50ul
    EUR 239
    LGR5(GPR49) Antibody 
    21659-100ul 100ul
    EUR 252
    LGR5(GPR49) Antibody 
    21659-50ul 50ul
    EUR 187
    Anti-LGR5 antibody
    PAab04765 100 ug
    EUR 412
    Anti-LGR5 antibody
    STJ11100682 50 µl
    EUR 287
    Description: The protein encoded by this gene is a leucine-rich repeat-containing receptor (LGR) and member of the G protein-coupled, 7-transmembrane receptor (GPCR) superfamily. The encoded protein is a receptor for R-spondins and is involved in the canonical Wnt signaling pathway. This protein plays a role in the formation and maintenance of adult intestinal stem cells during postembryonic development. Several transcript variants encoding different isoforms have been found for this gene.
    Anti-LGR5 antibody
    STJ112563 100 µl
    EUR 277
    Description: The protein encoded by this gene is a leucine-rich repeat-containing receptor (LGR) and member of the G protein-coupled, 7-transmembrane receptor (GPCR) superfamily. The encoded protein is a receptor for R-spondins and is involved in the canonical Wnt signaling pathway. This protein plays a role in the formation and maintenance of adult intestinal stem cells during postembryonic development. Several transcript variants encoding different isoforms have been found for this gene.
    Anti-LGR5 antibody
    STJ192662 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to LGR5
    LGR5 siRNA
    20-abx902972
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    LGR5 siRNA
    20-abx922502
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    LGR5 siRNA
    20-abx922503
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Rabbit Anti-LGR5 monoclonal antibody, clone TV43-15
    CABT-L640 100 ul
    EUR 777
    LGR5/GPR49 Conjugated Antibody
    C48810 100ul
    EUR 397
    LGR5(GPR49)  Conjugated Antibody
    C21659 100ul
    EUR 397
    Phospho-LGR5(Thr842) Antibody
    AF7954 200ul
    EUR 376
    Description: Phospho-LGR5(Thr842) Antibody detects endogenous levels of LGR5 only when phosphorylated at Thr842.
    LGR5 (GPR49) (loop1) Antibody
    abx031682-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    LGR5 (GPR49) (loop1) Antibody
    abx031682-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    LGR5 (Phospho-Thr842) Antibody
    13294-100ul 100ul
    EUR 252
    LGR5 (Phospho-Thr842) Antibody
    13294-50ul 50ul
    EUR 187
    LGR5 Antibody, HRP conjugated
    1-CSB-PA012906LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    LGR5 Antibody, FITC conjugated
    1-CSB-PA012906LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    LGR5 Antibody, Biotin conjugated
    1-CSB-PA012906LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    Antibody for Human LGR5
    SPC-764D 0.1mg
    EUR 353
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is unconjugated.
    Antibody for Human LGR5
    SPC-764D-A390 0.1mg
    EUR 400
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 390.
    Antibody for Human LGR5
    SPC-764D-A488 0.1mg
    EUR 399
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 488.
    Antibody for Human LGR5
    SPC-764D-A565 0.1mg
    EUR 399
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 565.
    Antibody for Human LGR5
    SPC-764D-A594 0.1mg
    EUR 399
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 594.
    Antibody for Human LGR5
    SPC-764D-A633 0.1mg
    EUR 399
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 633.
    Antibody for Human LGR5
    SPC-764D-A655 0.1mg
    EUR 399
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 655.
    Antibody for Human LGR5
    SPC-764D-A680 0.1mg
    EUR 399
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 680.
    Antibody for Human LGR5
    SPC-764D-A700 0.1mg
    EUR 399
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 700.
    Antibody for Human LGR5
    SPC-764D-ALP 0.1mg
    EUR 393
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Alkaline Phosphatase.
    Antibody for Human LGR5
    SPC-764D-APC 0.1mg
    EUR 398
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to APC .
    Antibody for Human LGR5
    SPC-764D-APCCY7 0.1mg
    EUR 470
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to APC/Cy7.
    Antibody for Human LGR5
    SPC-764D-BI 0.1mg
    EUR 395
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Biotin.
    Antibody for Human LGR5
    SPC-764D-DY350 0.1mg
    EUR 413
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 350.
    Antibody for Human LGR5
    SPC-764D-DY405 0.1mg
    EUR 402
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 405.
    Antibody for Human LGR5
    SPC-764D-DY488 0.1mg
    EUR 392
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 488.
    Antibody for Human LGR5
    SPC-764D-DY594 0.1mg
    EUR 394
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 594.
    Antibody for Human LGR5
    SPC-764D-DY633 0.1mg
    EUR 389
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 633.
    Antibody for Human LGR5
    SPC-764D-FITC 0.1mg
    EUR 391
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to FITC.
    Antibody for Human LGR5
    SPC-764D-HRP 0.1mg
    EUR 387
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to HRP.
    Antibody for Human LGR5
    SPC-764D-P594 0.1mg
    EUR 406
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to PE/ATTO 594.
    Antibody for Human LGR5
    SPC-764D-PCP 0.1mg
    EUR 398
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to PerCP.
    Antibody for Human LGR5
    SPC-764D-RPE 0.1mg
    EUR 396
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to RPE .
    Antibody for Human LGR5
    SPC-764D-STR 0.1mg
    EUR 397
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Streptavidin.
    Antibody for Human LGR5
    SPC-764S 0.012mg
    EUR 65
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is unconjugated.
    LGR5 Blocking Peptide
    AF7530-BP 1mg
    EUR 195
    LGR5 cloning plasmid
    CSB-CL012906HU-10ug 10ug
    EUR 873
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2724
    • Sequence: ATGGACACCTCCCGGCTCGGTGTGCTCCTGTCCTTGCCTGTGCTGCTGCAGCTGGCGACCGGGGGCAGCTCTCCCAGGTCTGGTGTGTTGCTGAGGGGCTGCCCCACACACTGTCATTGCGAGCCCGACGGCAGGATGTTGCTCAGGGTGGACTGCTCCGACCTGGGGCTCTCGG
    • Show more
    Description: A cloning plasmid for the LGR5 gene.
    LGR5 Blocking Peptide
    DF2816-BP 1mg
    EUR 195
    Monoclonal LGR5 Antibody, Clone: 2B5B9
    AMM03068G 0.1ml
    EUR 528
    Description: A Monoclonal antibody against Human LGR5. The antibodies are raised in Mouse and are from clone 2B5B9. This antibody is applicable in WB and IHC, FC, ICC, E
    Monoclonal LGR5 Antibody, Clone: 2B5C3
    AMM03069G 0.1ml
    EUR 528
    Description: A Monoclonal antibody against Human LGR5. The antibodies are raised in Mouse and are from clone 2B5C3. This antibody is applicable in WB and IHC, FC, ICC, E
    LGR5 (Phospho-Thr842) Conjugated Antibody
    C13294 100ul
    EUR 397
    GPR49/LGR5 alpha/beta Antibody
    48500-100ul 100ul
    EUR 333
    GPR49/LGR5 alpha/beta Antibody
    48500-50ul 50ul
    EUR 239
    Monoclonal LGR5/GPR49 Antibody, Clone: 349CT16.1.3.1
    AMM02389G 0.1ml
    EUR 484
    Description: A Monoclonal antibody against Human LGR5/GPR49. The antibodies are raised in Mouse and are from clone 349CT16.1.3.1. This antibody is applicable in FC, WB, E
    LGR5(GPR49) Blocking Peptide
    AF4102-BP 1mg
    EUR 195
    Rat LGR5 shRNA Plasmid
    20-abx989007
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse Lgr5 ELISA KIT
    ELI-14463m 96 Tests
    EUR 865

    LGR5 Rabbit Polyclonal Antibody