LGR5 Rabbit Polyclonal Antibody

LGR5 Rabbit Polyclonal Antibody

Contact Us Below To Order :

LGR5 Polyclonal Antibody
ES11504-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LGR5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
LGR5 Polyclonal Antibody
ES11504-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LGR5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
LGR5 Rabbit pAb
A10545-100ul 100 ul
EUR 308
LGR5 Rabbit pAb
A10545-200ul 200 ul
EUR 459
LGR5 Rabbit pAb
A10545-20ul 20 ul
EUR 183
LGR5 Rabbit pAb
A10545-50ul 50 ul
EUR 223
LGR5 Rabbit pAb
A19489-100ul 100 ul Ask for price
LGR5 Rabbit pAb
A19489-200ul 200 ul Ask for price
LGR5 Rabbit pAb
A19489-20ul 20 ul Ask for price
LGR5 Rabbit pAb
A19489-50ul 50 ul
EUR 308
Polyclonal LGR5 Antibody (loop2)
APR05065G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGR5 (loop2). This antibody is tested and proven to work in the following applications:
LGR5/GPR49 Rabbit mAb
A12327-100ul 100 ul
EUR 410
LGR5/GPR49 Rabbit mAb
A12327-200ul 200 ul
EUR 571
LGR5/GPR49 Rabbit mAb
A12327-20ul 20 ul
EUR 221
LGR5/GPR49 Rabbit mAb
A12327-50ul 50 ul
EUR 287
LGR5 antibody
20R-2773 50 ug
EUR 281
Description: Rabbit polyclonal LGR5 antibody
LGR5 Antibody
A1007-100
EUR 354
LGR5 Antibody
44974-100ul 100ul
EUR 252
LGR5 Antibody
44974-50ul 50ul
EUR 187
LGR5 Antibody
1-CSB-PA080695
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100
LGR5 Antibody
CSB-PA622827-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
LGR5 Antibody
CSB-PA622827-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
LGR5 Antibody
DF2816 200ul
EUR 304
Description: LGR5 antibody detects endogenous levels of total LGR5.
LGR5 Antibody
AF7530 200ul
EUR 376
Description: LGR5 Antibody detects endogenous levels of LGR5.
LGR5 Antibody
1-CSB-PA012906LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200
LGR5 Antibody
ABD2816 100 ug
EUR 438
Polyclonal LGR5 (GPR49) Antibody (loop1)
APR05064G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGR5 (GPR49) (loop1). This antibody is tested and proven to work in the following applications:
Polyclonal LGR5 (GPR49) Antibody (Center)
APR05066G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGR5 (GPR49) (Center). This antibody is tested and proven to work in the following applications:
Anti-LGR5/GPR49 Rabbit Monoclonal Antibody
M00239 100ug/vial
EUR 397
Description: Rabbit Monoclonal LGR5/GPR49 Antibody. Validated in Flow Cytometry, IP, WB and tested in Human, Mouse, Rat.
Polyclonal GPR49 / LGR5 Antibody (N-Terminus)
APR01956G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR49 / LGR5 (N-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal GPR49 / LGR5 Antibody (Cytoplasmic Domain)
APR01957G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR49 / LGR5 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
Polyclonal GPR49 / LGR5 Antibody (Cytoplasmic Domain)
APR01958G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR49 / LGR5 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
LGR5(GPR49) Antibody 
21659-100ul 100ul
EUR 252
LGR5(GPR49) Antibody 
21659-50ul 50ul
EUR 187
LGR5/GPR49 Antibody
48810-100ul 100ul
EUR 333
LGR5/GPR49 Antibody
48810-50ul 50ul
EUR 239
LGR5 (GPR49) Antibody
abx020041-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
LGR5 / GPR49 Antibody
abx031681-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
LGR5 / GPR49 Antibody
abx031681-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
LGR5 (loop2) Antibody
abx031683-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
LGR5 (loop2) Antibody
abx031683-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
LGR5(GPR49) Antibody
AF4102 200ul
EUR 376
Description: The antibody detects endogenous level of total LGR5(GPR49) protein.
LGR5 Conjugated Antibody
C44974 100ul
EUR 397
LGR5 (GPR49) Antibody
ABF4102 100 ug
EUR 438
anti- LGR5 antibody
FNab04765 100µg
EUR 585
  • Recommended dilution: IHC: 1:100-1:400
  • Immunogen: leucine-rich repeat-containing G protein-coupled receptor 5
  • Uniprot ID: O75473
  • Gene ID: 8549
  • Research Area: Signal Transduction
Description: Antibody raised against LGR5
Anti-LGR5 antibody
PAab04765 100 ug
EUR 412
Anti-LGR5 antibody
STJ11100682 50 µl
EUR 287
Description: The protein encoded by this gene is a leucine-rich repeat-containing receptor (LGR) and member of the G protein-coupled, 7-transmembrane receptor (GPCR) superfamily. The encoded protein is a receptor for R-spondins and is involved in the canonical Wnt signaling pathway. This protein plays a role in the formation and maintenance of adult intestinal stem cells during postembryonic development. Several transcript variants encoding different isoforms have been found for this gene.
Anti-LGR5 antibody
STJ112563 100 µl
EUR 277
Description: The protein encoded by this gene is a leucine-rich repeat-containing receptor (LGR) and member of the G protein-coupled, 7-transmembrane receptor (GPCR) superfamily. The encoded protein is a receptor for R-spondins and is involved in the canonical Wnt signaling pathway. This protein plays a role in the formation and maintenance of adult intestinal stem cells during postembryonic development. Several transcript variants encoding different isoforms have been found for this gene.
Anti-LGR5 antibody
STJ192662 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LGR5
LGR5 siRNA
20-abx902972
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
LGR5 siRNA
20-abx922502
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
LGR5 siRNA
20-abx922503
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Rabbit Anti-LGR5 monoclonal antibody, clone TV43-15
CABT-L640 100 ul
EUR 777
LGR5 (Phospho-Thr842) Antibody
13294-100ul 100ul
EUR 252
LGR5 (Phospho-Thr842) Antibody
13294-50ul 50ul
EUR 187
LGR5 (GPR49) (loop1) Antibody
abx031682-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
LGR5 (GPR49) (loop1) Antibody
abx031682-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
LGR5/GPR49 Conjugated Antibody
C48810 100ul
EUR 397
LGR5(GPR49)  Conjugated Antibody
C21659 100ul
EUR 397
LGR5 Antibody, HRP conjugated
1-CSB-PA012906LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
LGR5 Antibody, FITC conjugated
1-CSB-PA012906LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
LGR5 Antibody, Biotin conjugated
1-CSB-PA012906LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Phospho-LGR5(Thr842) Antibody
AF7954 200ul
EUR 376
Description: Phospho-LGR5(Thr842) Antibody detects endogenous levels of LGR5 only when phosphorylated at Thr842.
Antibody for Human LGR5
SPC-764D 0.1mg
EUR 353
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is unconjugated.
Antibody for Human LGR5
SPC-764D-A390 0.1mg
EUR 400
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 390.
Antibody for Human LGR5
SPC-764D-A488 0.1mg
EUR 399
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 488.
Antibody for Human LGR5
SPC-764D-A565 0.1mg
EUR 399
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 565.
Antibody for Human LGR5
SPC-764D-A594 0.1mg
EUR 399
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 594.
Antibody for Human LGR5
SPC-764D-A633 0.1mg
EUR 399
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 633.
Antibody for Human LGR5
SPC-764D-A655 0.1mg
EUR 399
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 655.
Antibody for Human LGR5
SPC-764D-A680 0.1mg
EUR 399
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 680.
Antibody for Human LGR5
SPC-764D-A700 0.1mg
EUR 399
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 700.
Antibody for Human LGR5
SPC-764D-ALP 0.1mg
EUR 393
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Alkaline Phosphatase.
Antibody for Human LGR5
SPC-764D-APC 0.1mg
EUR 398
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to APC .
Antibody for Human LGR5
SPC-764D-APCCY7 0.1mg
EUR 470
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to APC/Cy7.
Antibody for Human LGR5
SPC-764D-BI 0.1mg
EUR 395
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Biotin.
Antibody for Human LGR5
SPC-764D-DY350 0.1mg
EUR 413
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 350.
Antibody for Human LGR5
SPC-764D-DY405 0.1mg
EUR 402
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 405.
Antibody for Human LGR5
SPC-764D-DY488 0.1mg
EUR 392
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 488.
Antibody for Human LGR5
SPC-764D-DY594 0.1mg
EUR 394
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 594.
Antibody for Human LGR5
SPC-764D-DY633 0.1mg
EUR 389
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 633.
Antibody for Human LGR5
SPC-764D-FITC 0.1mg
EUR 391
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to FITC.
Antibody for Human LGR5
SPC-764D-HRP 0.1mg
EUR 387
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to HRP.
Antibody for Human LGR5
SPC-764D-P594 0.1mg
EUR 406
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to PE/ATTO 594.
Antibody for Human LGR5
SPC-764D-PCP 0.1mg
EUR 398
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to PerCP.
Antibody for Human LGR5
SPC-764D-RPE 0.1mg
EUR 396
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to RPE .
Antibody for Human LGR5
SPC-764D-STR 0.1mg
EUR 397
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Streptavidin.
Antibody for Human LGR5
SPC-764S 0.012mg
EUR 65
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is unconjugated.
LGR5 Blocking Peptide
DF2816-BP 1mg
EUR 195
LGR5 Blocking Peptide
AF7530-BP 1mg
EUR 195
LGR5 cloning plasmid
CSB-CL012906HU-10ug 10ug
EUR 873
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2724
  • Sequence: ATGGACACCTCCCGGCTCGGTGTGCTCCTGTCCTTGCCTGTGCTGCTGCAGCTGGCGACCGGGGGCAGCTCTCCCAGGTCTGGTGTGTTGCTGAGGGGCTGCCCCACACACTGTCATTGCGAGCCCGACGGCAGGATGTTGCTCAGGGTGGACTGCTCCGACCTGGGGCTCTCGG
  • Show more
Description: A cloning plasmid for the LGR5 gene.
GPR49/LGR5 alpha/beta Antibody
48500-100ul 100ul
EUR 333
GPR49/LGR5 alpha/beta Antibody
48500-50ul 50ul
EUR 239
LGR5 (Phospho-Thr842) Conjugated Antibody
C13294 100ul
EUR 397
Monoclonal LGR5 Antibody, Clone: 2B5B9
AMM03068G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human LGR5. The antibodies are raised in Mouse and are from clone 2B5B9. This antibody is applicable in WB and IHC, FC, ICC, E
Monoclonal LGR5 Antibody, Clone: 2B5C3
AMM03069G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human LGR5. The antibodies are raised in Mouse and are from clone 2B5C3. This antibody is applicable in WB and IHC, FC, ICC, E
Monoclonal LGR5/GPR49 Antibody, Clone: 349CT16.1.3.1
AMM02389G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human LGR5/GPR49. The antibodies are raised in Mouse and are from clone 349CT16.1.3.1. This antibody is applicable in FC, WB, E
Mouse Lgr5 ELISA KIT
ELI-14463m 96 Tests
EUR 865
LGR5 ELISA KIT|Human
EF010665 96 Tests
EUR 689
Human LGR5 ELISA KIT
ELI-43187h 96 Tests
EUR 824

LGR5 Rabbit Polyclonal Antibody