GPR64 Rabbit Polyclonal Antibody

GPR64 Rabbit Polyclonal Antibody

Contact Us Below To Order :

GPR64 Antibody
36911-100ul 100ul
EUR 252
GPR64 Antibody
1-CSB-PA912224
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GPR64. Recognizes GPR64 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200
GPR64 Antibody
DF2758 200ul
EUR 304
Description: GPR64 antibody detects endogenous levels of total GPR64.
GPR64 Antibody
ABD2758 100 ug
EUR 438
Gpr64/ Rat Gpr64 ELISA Kit
ELI-31709r 96 Tests
EUR 886
Polyclonal ADGRG2 / GPR64 Antibody (C-Terminus)
APR14845G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADGRG2 / GPR64 (C-Terminus). This antibody is tested and proven to work in the following applications:
GPR64 Conjugated Antibody
C36911 100ul
EUR 397
Anti-GPR64 antibody
STJ192657 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPR64
GPR64 siRNA
20-abx902288
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPR64 siRNA
20-abx918545
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPR64 siRNA
20-abx918546
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPR64 Blocking Peptide
DF2758-BP 1mg
EUR 195
GPR64 cloning plasmid
CSB-CL811638HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2853
  • Sequence: ATGGTTTTCTCTGTCAGGCAGTGTGGCCATGTTGGCAGAACTGAAGAAGTTTTACTGACGTTCAAGATATTCCTTGTCATCATTTGTCTTCATGTCGTTCTGGTAACATCCCTGGAAGAAGATACTGATAATTCCAGTTTGTCACCACCACCTGAGGTTGAAACAACAAGCCTCA
  • Show more
Description: A cloning plasmid for the GPR64 gene.
Rat GPR64 shRNA Plasmid
20-abx988100
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GPR64 shRNA Plasmid
20-abx956849
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse GPR64 shRNA Plasmid
20-abx982267
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
G-Protein Coupled Receptor 64 (GPR64) Antibody
abx147547-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Gpr64 ORF Vector (Rat) (pORF)
ORF067819 1.0 ug DNA
EUR 506
GPR64 ORF Vector (Human) (pORF)
ORF013198 1.0 ug DNA
EUR 354
Gpr64 ORF Vector (Mouse) (pORF)
ORF046562 1.0 ug DNA
EUR 506
Gpr64 ORF Vector (Mouse) (pORF)
ORF046563 1.0 ug DNA
EUR 506
Gpr64 ORF Vector (Mouse) (pORF)
ORF046564 1.0 ug DNA
EUR 506
Gpr64 ORF Vector (Mouse) (pORF)
ORF046565 1.0 ug DNA
EUR 506
Gpr64 sgRNA CRISPR Lentivector set (Rat)
K7196001 3 x 1.0 ug
EUR 339
Gpr64 sgRNA CRISPR Lentivector set (Mouse)
K4391901 3 x 1.0 ug
EUR 339
GPR64 sgRNA CRISPR Lentivector set (Human)
K0892501 3 x 1.0 ug
EUR 339
Gpr64 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7196002 1.0 ug DNA
EUR 154
Gpr64 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7196003 1.0 ug DNA
EUR 154
Gpr64 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7196004 1.0 ug DNA
EUR 154
Gpr64 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4391902 1.0 ug DNA
EUR 154
Gpr64 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4391903 1.0 ug DNA
EUR 154
Gpr64 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4391904 1.0 ug DNA
EUR 154
GPR64 sgRNA CRISPR Lentivector (Human) (Target 1)
K0892502 1.0 ug DNA
EUR 154
GPR64 sgRNA CRISPR Lentivector (Human) (Target 2)
K0892503 1.0 ug DNA
EUR 154
GPR64 sgRNA CRISPR Lentivector (Human) (Target 3)
K0892504 1.0 ug DNA
EUR 154
GPR64 Protein Vector (Rat) (pPB-C-His)
PV271274 500 ng
EUR 1191
GPR64 Protein Vector (Rat) (pPB-N-His)
PV271275 500 ng
EUR 1191
GPR64 Protein Vector (Rat) (pPM-C-HA)
PV271276 500 ng
EUR 1191
GPR64 Protein Vector (Rat) (pPM-C-His)
PV271277 500 ng
EUR 1191
GPR64 Protein Vector (Mouse) (pPB-C-His)
PV186246 500 ng
EUR 1065
GPR64 Protein Vector (Mouse) (pPB-N-His)
PV186247 500 ng
EUR 1065
GPR64 Protein Vector (Mouse) (pPM-C-HA)
PV186248 500 ng
EUR 1065
GPR64 Protein Vector (Mouse) (pPM-C-His)
PV186249 500 ng
EUR 1065
GPR64 Protein Vector (Mouse) (pPB-C-His)
PV186250 500 ng
EUR 1065
GPR64 Protein Vector (Mouse) (pPB-N-His)
PV186251 500 ng
EUR 1065
GPR64 Protein Vector (Mouse) (pPM-C-HA)
PV186252 500 ng
EUR 1065
GPR64 Protein Vector (Mouse) (pPM-C-His)
PV186253 500 ng
EUR 1065
GPR64 Protein Vector (Mouse) (pPB-C-His)
PV186254 500 ng
EUR 1065
GPR64 Protein Vector (Mouse) (pPB-N-His)
PV186255 500 ng
EUR 1065
GPR64 Protein Vector (Mouse) (pPM-C-HA)
PV186256 500 ng
EUR 1065
GPR64 Protein Vector (Mouse) (pPM-C-His)
PV186257 500 ng
EUR 1065
GPR64 Protein Vector (Mouse) (pPB-C-His)
PV186258 500 ng
EUR 1065
GPR64 Protein Vector (Mouse) (pPB-N-His)
PV186259 500 ng
EUR 1065
GPR64 Protein Vector (Mouse) (pPM-C-HA)
PV186260 500 ng
EUR 1065
GPR64 Protein Vector (Mouse) (pPM-C-His)
PV186261 500 ng
EUR 1065
GPR64 Protein Vector (Human) (pPB-C-His)
PV052789 500 ng
EUR 481
GPR64 Protein Vector (Human) (pPB-N-His)
PV052790 500 ng
EUR 481
GPR64 Protein Vector (Human) (pPM-C-HA)
PV052791 500 ng
EUR 481
GPR64 Protein Vector (Human) (pPM-C-His)
PV052792 500 ng
EUR 481
Gpr64 3'UTR Luciferase Stable Cell Line
TU109037 1.0 ml Ask for price
Gpr64 3'UTR Luciferase Stable Cell Line
TU205387 1.0 ml Ask for price
Gpr64 3'UTR GFP Stable Cell Line
TU159037 1.0 ml Ask for price
Gpr64 3'UTR GFP Stable Cell Line
TU255387 1.0 ml Ask for price
GPR64 3'UTR GFP Stable Cell Line
TU059176 1.0 ml
EUR 2333
GPR64 3'UTR Luciferase Stable Cell Line
TU009176 1.0 ml
EUR 2333
GPR64 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV628903 1.0 ug DNA
EUR 1355
GPR64 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV628907 1.0 ug DNA
EUR 1355
GPR64 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV628908 1.0 ug DNA
EUR 1355
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GPR64 Rabbit Polyclonal Antibody