GLP2R Rabbit Polyclonal Antibody

GLP2R Rabbit Polyclonal Antibody

Contact Us Below To Order :

    GLP2R Rabbit pAb

    A6602-100ul 100 ul
    EUR 308

    GLP2R Rabbit pAb

    A6602-200ul 200 ul
    EUR 459

    GLP2R Rabbit pAb

    A6602-20ul 20 ul
    EUR 183

    GLP2R Rabbit pAb

    A6602-50ul 50 ul
    EUR 223

    Polyclonal GLP2R Antibody (Internal)

    APR01964G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GLP2R (Internal). This antibody is tested and proven to work in the following applications:

    GLP2R antibody

    70R-5959 50 ug
    EUR 467
    Description: Rabbit polyclonal GLP2R antibody raised against the N terminal of GLP2R

    GLP2R Antibody

    ABD10216 100 ug
    EUR 438

    GLP2R antibody

    39037-100ul 100ul
    EUR 252

    GLP2R Antibody

    43319-100ul 100ul
    EUR 252

    GLP2R Antibody

    DF10216 200ul
    EUR 304
    Description: GLP2R Antibody detects endogenous levels of total GLP2R.

    GLP2R Antibody

    1-CSB-PA286159
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against GLP2R. Recognizes GLP2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

    GLP2R Antibody

    1-CSB-PA009515ESR2HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against GLP2R. Recognizes GLP2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    GLP2R Antibody

    1-CSB-PA025580
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against GLP2R. Recognizes GLP2R from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

    Polyclonal GLP2R Antibody (C-Terminus)

    APR01965G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GLP2R (C-Terminus). This antibody is tested and proven to work in the following applications:

    Glp2r/ Rat Glp2r ELISA Kit

    ELI-43481r 96 Tests
    EUR 886

    GLP2R Conjugated Antibody

    C39037 100ul
    EUR 397

    Anti-GLP2R Antibody

    STJ501181 100 µg
    EUR 476

    Anti-GLP2R antibody

    STJ28685 100 µl
    EUR 277
    Description: This gene encodes a G protein-coupled receptor that is closely related to the glucagon receptor and binds to glucagon-like peptide-2 (GLP2). Signalling through GLP2 stimulates intestinal growth and increases villus height in the small intestine, concomitant with increased crypt cell proliferation and decreased enterocyte apoptosis.

    Anti-GLP2R antibody

    STJ192649 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to GLP2R

    GLP2R siRNA

    20-abx902184
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    GLP2R siRNA

    20-abx918019
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    GLP2R siRNA

    20-abx918020
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    anti-GLP2R

    YF-PA25313 50 ul
    EUR 334
    Description: Mouse polyclonal to GLP2R

    Anti-GLP2R Antibody BIOTIN

    STJ501182 100 µg
    EUR 586

    Anti-GLP2R Antibody FITC

    STJ501183 100 µg
    EUR 586

    GLP2R cloning plasmid

    CSB-CL009515HU-10ug 10ug
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1662
    • Sequence: ATGAAGCTGGGATCGAGCAGGGCAGGGCCTGGGAGAGGAAGCGCGGGACTCCTGCCTGGCGTCCACGAGCTGCCCATGGGCATCCCTGCCCCCTGGGGGACCAGTCCTCTCTCCTTCCACAGGAAGTGCTCTCTCTGGGCCCCTGGGAGGCCCTTCCTCACTCTGGTCCTGCTGG
    • Show more
    Description: A cloning plasmid for the GLP2R gene.

    GLP2R Blocking Peptide

    33R-4510 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GLP2R antibody, catalog no. 70R-5959

    GLP2R Blocking Peptide

    DF10216-BP 1mg
    EUR 195

    Anti-GLP2R (1F2)

    YF-MA16783 100 ug
    EUR 363
    Description: Mouse monoclonal to GLP2R

    Mouse GLP2R shRNA Plasmid

    20-abx979251
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat GLP2R shRNA Plasmid

    20-abx986050
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    GLP2R ELISA KIT|Human

    EF005042 96 Tests
    EUR 689

    Human GLP2R shRNA Plasmid

    20-abx956181
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    GLP2R Recombinant Protein (Human)

    RP039493 100 ug Ask for price

    GLP2R Recombinant Protein (Rat)

    RP202799 100 ug Ask for price

    GLP2R Recombinant Protein (Mouse)

    RP136721 100 ug Ask for price

    Monoclonal GLP2R Antibody (monoclonal) (M05), Clone: 1F2

    AMM03584G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human GLP2R (monoclonal) (M05). The antibodies are raised in mouse and are from clone 1F2. This antibody is applicable in WB, E

    Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody

    20-abx005063
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody

    20-abx005620
    • EUR 411.00
    • EUR 592.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody

    20-abx320784
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody

    abx215627-100ug 100 ug
    EUR 439
    • Shipped within 5-10 working days.

    Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody

    20-abx213173
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody

    20-abx210518
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Glp2r ORF Vector (Rat) (pORF)

    ORF067601 1.0 ug DNA
    EUR 506

    Glp2r ORF Vector (Mouse) (pORF)

    ORF045575 1.0 ug DNA
    EUR 506

    GLP2R ORF Vector (Human) (pORF)

    ORF013165 1.0 ug DNA
    EUR 354

    pECMV-Glp2r-m-FLAG Plasmid

    PVT15234 2 ug
    EUR 325

    GLP2R ELISA Kit (Rat) (OKEH08217)

    OKEH08217 96 Wells
    EUR 896
    Description: Description of target: proglucagon-derived peptide involved in the regulation of energy homeostasis via effects on nutrient absorption and maintenance of gut mucosal epithelial integrity and may also play a role in the central nervous system [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

    GLP2R ELISA Kit (Human) (OKEI00296)

    OKEI00296 96 Wells
    EUR 767
    Description: Description of target: This is a receptor for glucagon-like peptide 2. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

    GLP2R ELISA Kit (Rat) (OKWB00388)

    OKWB00388 96 Wells
    EUR 572
    Description: Description of target: This is a receptor for glucagon-like peptide 2. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase. ;Species reactivity: Rat;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL

    GLP2R sgRNA CRISPR Lentivector set (Human)

    K0867201 3 x 1.0 ug
    EUR 339

    Glp2r sgRNA CRISPR Lentivector set (Mouse)

    K4372401 3 x 1.0 ug
    EUR 339

    Glp2r sgRNA CRISPR Lentivector set (Rat)

    K6909201 3 x 1.0 ug
    EUR 339

    GLP2R sgRNA CRISPR Lentivector (Human) (Target 1)

    K0867202 1.0 ug DNA
    EUR 154

    GLP2R sgRNA CRISPR Lentivector (Human) (Target 2)

    K0867203 1.0 ug DNA
    EUR 154

    GLP2R sgRNA CRISPR Lentivector (Human) (Target 3)

    K0867204 1.0 ug DNA
    EUR 154

    Glp2r sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4372402 1.0 ug DNA
    EUR 154

    Glp2r sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4372403 1.0 ug DNA
    EUR 154

    Glp2r sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4372404 1.0 ug DNA
    EUR 154

    Glp2r sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6909202 1.0 ug DNA
    EUR 154

    Glp2r sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6909203 1.0 ug DNA
    EUR 154

    Glp2r sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6909204 1.0 ug DNA
    EUR 154

    GLP2R Protein Vector (Human) (pPB-C-His)

    PV052657 500 ng
    EUR 481

    GLP2R Protein Vector (Human) (pPB-N-His)

    PV052658 500 ng
    EUR 481

    GLP2R Protein Vector (Human) (pPM-C-HA)

    PV052659 500 ng
    EUR 481

    GLP2R Protein Vector (Human) (pPM-C-His)

    PV052660 500 ng
    EUR 481

    GLP2R Protein Vector (Rat) (pPB-C-His)

    PV270402 500 ng
    EUR 603

    GLP2R Protein Vector (Rat) (pPB-N-His)

    PV270403 500 ng
    EUR 603

    GLP2R Protein Vector (Rat) (pPM-C-HA)

    PV270404 500 ng
    EUR 603

    GLP2R Protein Vector (Rat) (pPM-C-His)

    PV270405 500 ng
    EUR 603

    GLP2R Protein Vector (Mouse) (pPB-C-His)

    PV182298 500 ng
    EUR 603

    GLP2R Protein Vector (Mouse) (pPB-N-His)

    PV182299 500 ng
    EUR 603

    GLP2R Protein Vector (Mouse) (pPM-C-HA)

    PV182300 500 ng
    EUR 603

    GLP2R Protein Vector (Mouse) (pPM-C-His)

    PV182301 500 ng
    EUR 603

    GLP2R Rabbit Polyclonal Antibody