GPR84 Rabbit Polyclonal Antibody

GPR84 Rabbit Polyclonal Antibody

Contact Us Below To Order :

GPR84 Polyclonal Antibody
A67298 100 µg
EUR 570.55
Description: The best epigenetics products
Polyclonal GPR84 Antibody (Center)
APR16623G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR84 (Center). This antibody is tested and proven to work in the following applications:
GPR84 Antibody
ABD2769 100 ug
EUR 438
GPR84 Antibody
ABD2811 100 ug
EUR 438
GPR84 Antibody
44971-100ul 100ul
EUR 252
GPR84 Antibody
44971-50ul 50ul
EUR 187
GPR84 Antibody
DF2769 200ul
EUR 304
Description: GPR84 antibody detects endogenous levels of total GPR84.
GPR84 Antibody
DF2811 200ul
EUR 304
Description: GPR84 antibody detects endogenous levels of total GPR84.
GPR84 Antibody
1-CSB-PA865107LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
Polyclonal GPR84 Antibody (Cytoplasmic Domain)
APR16624G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR84 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
Polyclonal GPR84 Antibody (Extracellular Domain)
APR16625G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR84 (Extracellular Domain). This antibody is tested and proven to work in the following applications:
GPR84 Polyclonal Antibody, HRP Conjugated
A67299 100 µg
EUR 570.55
Description: kits suitable for this type of research
GPR84 Polyclonal Antibody, FITC Conjugated
A67300 100 µg
EUR 570.55
Description: fast delivery possible
GPR84 Polyclonal Antibody, Biotin Conjugated
A67301 100 µg
EUR 570.55
Description: reagents widely cited
GPR84 Conjugated Antibody
C44971 100ul
EUR 397
GPR84 Antibody (HRP)
20-abx310835
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GPR84 Antibody (FITC)
20-abx310836
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GPR84 Antibody (Biotin)
20-abx310837
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-GPR84 antibody
STJ192641 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPR84
GPR84 siRNA
20-abx918560
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPR84 siRNA
20-abx918561
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPR84 Antibody, HRP conjugated
1-CSB-PA865107LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
GPR84 Antibody, FITC conjugated
1-CSB-PA865107LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
GPR84 Antibody, Biotin conjugated
1-CSB-PA865107LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
GPR84 antagonist 8
HY-112562 10mM/1mL
EUR 744
GPR84 cloning plasmid
CSB-CL865107HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1191
  • Sequence: atgtggaacagctctgacgccaacttctcctgctaccatgagtctgtgctgggctatcgttatgttgcagttagctggggggtggtggtggctgtgacaggcaccgtgggcaatgtgctcaccctactggccttggccatccagcccaagctccgtacccgattcaacctgctca
  • Show more
Description: A cloning plasmid for the GPR84 gene.
GPR84 Blocking Peptide
DF2769-BP 1mg
EUR 195
GPR84 Blocking Peptide
DF2811-BP 1mg
EUR 195
pET24a-GPR84 Plasmid
PVTB50010-1a 2 ug
EUR 356
Mouse GPR84 shRNA Plasmid
20-abx979070
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GPR84 shRNA Plasmid
20-abx959986
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
GPR84 Recombinant Protein (Human)
RP013903 100 ug Ask for price
pCMV-SPORT6-Gpr84 Plasmid
PVTB50010S 2 ug
EUR 356
GPR84 Recombinant Protein (Rat)
RP203474 100 ug Ask for price
GPR84 Recombinant Protein (Mouse)
RP139724 100 ug Ask for price
Monoclonal GPR84 Antibody (monoclonal) (M02), Clone: 5B7
APR16626G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GPR84 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 5B7. This antibody is applicable in WB, E
Monoclonal GPR84 Antibody (monoclonal) (M03), Clone: 1D9
APR16627G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GPR84 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1D9. This antibody is applicable in WB, E
G-Protein Coupled Receptor 84 (GPR84) Antibody
20-abx147333
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
G-Protein Coupled Receptor 84 (GPR84) Antibody
abx029499-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
G-Protein Coupled Receptor 84 (GPR84) Antibody
abx029499-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
G-Protein Coupled Receptor 84 (GPR84) Antibody
20-abx310834
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GPR84 ORF Vector (Human) (pORF)
ORF004635 1.0 ug DNA
EUR 95
Gpr84 ORF Vector (Rat) (pORF)
ORF067826 1.0 ug DNA
EUR 506
Gpr84 ORF Vector (Mouse) (pORF)
ORF046576 1.0 ug DNA
EUR 506
GPR84 sgRNA CRISPR Lentivector set (Human)
K0893501 3 x 1.0 ug
EUR 339
Gpr84 sgRNA CRISPR Lentivector set (Mouse)
K3260601 3 x 1.0 ug
EUR 339
Gpr84 sgRNA CRISPR Lentivector set (Rat)
K6609101 3 x 1.0 ug
EUR 339
GPR84 sgRNA CRISPR Lentivector (Human) (Target 1)
K0893502 1.0 ug DNA
EUR 154
GPR84 sgRNA CRISPR Lentivector (Human) (Target 2)
K0893503 1.0 ug DNA
EUR 154
GPR84 sgRNA CRISPR Lentivector (Human) (Target 3)
K0893504 1.0 ug DNA
EUR 154
Gpr84 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3260602 1.0 ug DNA
EUR 154
Gpr84 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3260603 1.0 ug DNA
EUR 154
Gpr84 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3260604 1.0 ug DNA
EUR 154
Gpr84 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6609102 1.0 ug DNA
EUR 154
Gpr84 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6609103 1.0 ug DNA
EUR 154
Gpr84 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6609104 1.0 ug DNA
EUR 154
GPR84 Protein Vector (Rat) (pPB-C-His)
PV271302 500 ng
EUR 603
GPR84 Protein Vector (Rat) (pPB-N-His)
PV271303 500 ng
EUR 603

GPR84 Rabbit Polyclonal Antibody