MYH1 Rabbit Polyclonal Antibody

MYH1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    MYH1 Polyclonal Antibody

    ABP59360-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human MYH1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of MYH1 from Human, Mouse. This MYH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH1 protein

    MYH1 Polyclonal Antibody

    ES11981-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MYH1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

    MYH1 Polyclonal Antibody

    ES11981-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MYH1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

    MYH1 Rabbit pAb

    A6935-100ul 100 ul
    EUR 308

    MYH1 Rabbit pAb

    A6935-200ul 200 ul
    EUR 459

    MYH1 Rabbit pAb

    A6935-20ul 20 ul
    EUR 183

    MYH1 Rabbit pAb

    A6935-50ul 50 ul
    EUR 223

    MYH1 Antibody

    35828-100ul 100ul
    EUR 252

    MYH1 Antibody

    31804-100ul 100ul
    EUR 252

    MYH1 Antibody

    1-CSB-PA877584
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against MYH1. Recognizes MYH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

    MYH1 Antibody

    1-CSB-PA791340
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against MYH1. Recognizes MYH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

    MYH1 Antibody

    1-CSB-PA015289ESR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against MYH1. Recognizes MYH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    MYH1 antibody

    70R-3929 50 ug
    EUR 467
    Description: Rabbit polyclonal MYH1 antibody raised against the N terminal of MYH1

    Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

    DLR-MYH1-Hu-48T 48T
    EUR 479
    • Should the Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

    Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

    DLR-MYH1-Hu-96T 96T
    EUR 621
    • Should the Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

    Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

    DLR-MYH1-Mu-48T 48T
    EUR 489
    • Should the Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

    DLR-MYH1-Mu-96T 96T
    EUR 635
    • Should the Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

    RDR-MYH1-Hu-48Tests 48 Tests
    EUR 500

    Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

    RDR-MYH1-Hu-96Tests 96 Tests
    EUR 692

    Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

    RDR-MYH1-Mu-48Tests 48 Tests
    EUR 511

    Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

    RDR-MYH1-Mu-96Tests 96 Tests
    EUR 709

    Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

    RD-MYH1-Hu-48Tests 48 Tests
    EUR 478

    Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

    RD-MYH1-Hu-96Tests 96 Tests
    EUR 662

    Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

    RD-MYH1-Mu-48Tests 48 Tests
    EUR 489

    Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

    RD-MYH1-Mu-96Tests 96 Tests
    EUR 677

    MYH1 Conjugated Antibody

    C31804 100ul
    EUR 397

    MYH1 Conjugated Antibody

    C35828 100ul
    EUR 397

    anti- MYH1 antibody

    FNab05469 100µg
    EUR 585
    • Recommended dilution: WB: 1:500 - 1:2000
    • IHC: 1:50 - 1:200
    • IF: 1:50 - 1:100
    • Immunogen: myosin, heavy chain 1, skeletal muscle, adult
    • Uniprot ID: P12882
    • Gene ID: 4619
    • Research Area: Cancer, Immunology, Developmental biology
    Description: Antibody raised against MYH1

    anti- MYH1 antibody

    FNab05470 100µg
    EUR 548.75
    • Immunogen: myosin, heavy chain 1, skeletal muscle, adult
    • Uniprot ID: P12882
    • Gene ID: 4619
    • Research Area: Cancer, Immunology, Developmental biology
    Description: Antibody raised against MYH1

    Anti-MYH1 antibody

    PAab05469 100 ug
    EUR 412

    Anti-MYH1 antibody

    PAab05470 100 ug
    EUR 386

    Anti-MYH1 antibody

    STJ29015 100 µl
    EUR 277
    Description: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development.

    Anti-MYH1 antibody

    STJ193139 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to MYH1

    Myosin heavy polypeptide 1 (MYH1) polyclonal antibody

    ABP-PAB-01616 100 ug Ask for price
      • Product line: Miscellaneous
      • Brand:

    Rabbit Myosin 1(MYH1) ELISA kit

    E04M0413-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Myosin 1(MYH1) ELISA kit

    E04M0413-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Myosin 1(MYH1) ELISA kit

    E04M0413-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    MYH1 siRNA

    20-abx925144
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MYH1 siRNA

    20-abx925145
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MYH1 Blocking Peptide

    33R-4695 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MYH1 antibody, catalog no. 70R-3929

    MYH1 cloning plasmid

    CSB-CL015289HU-10ug 10ug
    EUR 2770
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 5820
    • Sequence: ATGAGTTCTGACTCTGAGATGGCCATTTTTGGGGAGGCTGCTCCTTTCCTCCGAAAGTCTGAAAGGGAGCGAATTGAAGCCCAGAACAAGCCTTTTGATGCCAAGACATCAGTCTTTGTGGTGGACCCTAAGGAGTCCTTTGTGAAAGCAACAGTGCAGAGCAGGGAAGGGGGGA
    • Show more
    Description: A cloning plasmid for the MYH1 gene.

    Human MYH1 ELISA Kit

    ELA-E0161h 96 Tests
    EUR 824

    MYH1 ELISA KIT|Human

    EF000470 96 Tests
    EUR 689

    Mouse MYH1 shRNA Plasmid

    20-abx971645
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human MYH1 shRNA Plasmid

    20-abx953047
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse)

    4-PAA754Mu01
    • EUR 236.00
    • EUR 2338.00
    • EUR 586.00
    • EUR 294.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1)

    Myh1 ORF Vector (Rat) (pORF)

    ORF070975 1.0 ug DNA
    EUR 2080

    MYH1 ORF Vector (Human) (pORF)

    ORF013840 1.0 ug DNA
    EUR 354

    Myh1 ORF Vector (Mouse) (pORF)

    ORF050850 1.0 ug DNA
    EUR 1572

    MYH1 ELISA Kit (Mouse) (OKCD02740)

    OKCD02740 96 Wells
    EUR 779
    Description: Description of target: Muscle contraction. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.2 pg/mL

    MYH1 ELISA Kit (Human) (OKCD06765)

    OKCD06765 96 Wells
    EUR 753
    Description: Description of target: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin hea;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

    MYH1 ELISA Kit (Mouse) (OKCD09540)

    OKCD09540 96 Wells
    EUR 740
    Description: Description of target: Muscle contraction. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.137ng/mL.

    MYH1 ELISA Kit (Mouse) (OKEH07076)

    OKEH07076 96 Wells
    EUR 662
    Description: Description of target: Muscle contraction. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.5 pg/mL

    MYH1 ELISA Kit (Pig) (OKEH03815)

    OKEH03815 96 Wells
    EUR 779
    Description: Description of target: Muscle contraction.;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 35 pg/mL

    MYH1 Rabbit Polyclonal Antibody