MYH1 Rabbit Polyclonal Antibody

MYH1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

MYH1 Polyclonal Antibody

ABP59360-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MYH1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MYH1 from Human, Mouse. This MYH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH1 protein

MYH1 Polyclonal Antibody

ABP59360-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MYH1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MYH1 from Human, Mouse. This MYH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH1 protein

MYH1 Polyclonal Antibody

ABP59360-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MYH1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MYH1 from Human, Mouse. This MYH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH1 protein

MYH1 Rabbit pAb

A6935-100ul 100 ul
EUR 308

MYH1 Rabbit pAb

A6935-200ul 200 ul
EUR 459

MYH1 Rabbit pAb

A6935-20ul 20 ul
EUR 183

MYH1 Rabbit pAb

A6935-50ul 50 ul
EUR 223

MYH1 antibody

70R-3929 50 ug
EUR 467
Description: Rabbit polyclonal MYH1 antibody raised against the N terminal of MYH1

MYH1 Antibody

35828-100ul 100ul
EUR 252

MYH1 Antibody

31804-100ul 100ul
EUR 252

MYH1 Antibody

1-CSB-PA877584
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MYH1. Recognizes MYH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MYH1 Antibody

1-CSB-PA791340
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MYH1. Recognizes MYH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

MYH1 Antibody

1-CSB-PA015289ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MYH1. Recognizes MYH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

DLR-MYH1-Hu-48T 48T
EUR 479
  • Should the Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

DLR-MYH1-Hu-96T 96T
EUR 621
  • Should the Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

DLR-MYH1-Mu-48T 48T
EUR 489
  • Should the Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

DLR-MYH1-Mu-96T 96T
EUR 635
  • Should the Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RD-MYH1-Hu-48Tests 48 Tests
EUR 478

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RD-MYH1-Hu-96Tests 96 Tests
EUR 662

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RD-MYH1-Mu-48Tests 48 Tests
EUR 489

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RD-MYH1-Mu-96Tests 96 Tests
EUR 677

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RDR-MYH1-Hu-48Tests 48 Tests
EUR 500

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RDR-MYH1-Hu-96Tests 96 Tests
EUR 692

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RDR-MYH1-Mu-48Tests 48 Tests
EUR 511

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit

RDR-MYH1-Mu-96Tests 96 Tests
EUR 709

MYH1 Conjugated Antibody

C35828 100ul
EUR 397

MYH1 Conjugated Antibody

C31804 100ul
EUR 397

anti- MYH1 antibody

FNab05469 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: myosin, heavy chain 1, skeletal muscle, adult
  • Uniprot ID: P12882
  • Gene ID: 4619
  • Research Area: Cancer, Immunology, Developmental biology
Description: Antibody raised against MYH1

anti- MYH1 antibody

FNab05470 100µg
EUR 548.75
  • Immunogen: myosin, heavy chain 1, skeletal muscle, adult
  • Uniprot ID: P12882
  • Gene ID: 4619
  • Research Area: Cancer, Immunology, Developmental biology
Description: Antibody raised against MYH1

Anti-MYH1 antibody

PAab05469 100 ug
EUR 412

Anti-MYH1 antibody

PAab05470 100 ug
EUR 386

Anti-MYH1 antibody

STJ29015 100 µl
EUR 277
Description: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development.

Anti-MYH1 antibody

STJ193139 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MYH1

Myosin heavy polypeptide 1 (MYH1) polyclonal antibody

ABP-PAB-01616 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

Rabbit Myosin 1(MYH1) ELISA kit

E04M0413-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Myosin 1(MYH1) ELISA kit

E04M0413-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Myosin 1(MYH1) ELISA kit

E04M0413-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

MYH1 siRNA

20-abx925144
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYH1 siRNA

20-abx925145
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYH1 cloning plasmid

CSB-CL015289HU-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5820
  • Sequence: ATGAGTTCTGACTCTGAGATGGCCATTTTTGGGGAGGCTGCTCCTTTCCTCCGAAAGTCTGAAAGGGAGCGAATTGAAGCCCAGAACAAGCCTTTTGATGCCAAGACATCAGTCTTTGTGGTGGACCCTAAGGAGTCCTTTGTGAAAGCAACAGTGCAGAGCAGGGAAGGGGGGA
  • Show more
Description: A cloning plasmid for the MYH1 gene.

MYH1 Blocking Peptide

33R-4695 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MYH1 antibody, catalog no. 70R-3929

Human MYH1 ELISA Kit

ELA-E0161h 96 Tests
EUR 824

MYH1 ELISA KIT|Human

EF000470 96 Tests
EUR 689

Human MYH1 shRNA Plasmid

20-abx953047
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MYH1 shRNA Plasmid

20-abx971645
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse)

4-PAA754Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1)

Myh1 ORF Vector (Mouse) (pORF)

ORF050850 1.0 ug DNA
EUR 1572

Myh1 ORF Vector (Rat) (pORF)

ORF070975 1.0 ug DNA
EUR 2080

MYH1 ORF Vector (Human) (pORF)

ORF013840 1.0 ug DNA
EUR 354

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig)

4-PAA754Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (Tyr585~Ala794)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1)

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), APC

4-PAA754Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with APC.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), Biotinylated

4-PAA754Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with Biotin.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), Cy3

4-PAA754Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with Cy3.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), FITC

4-PAA754Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with FITC.

MYH1 Rabbit Polyclonal Antibody