NOXA1 Rabbit Polyclonal Antibody

NOXA1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

NOXA1 Polyclonal Antibody

ABP59499-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NOXA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NOXA1 from Human. This NOXA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOXA1 protein

NOXA1 Polyclonal Antibody

ES11975-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NOXA1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOXA1 Polyclonal Antibody

ES11975-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NOXA1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOXA1 Rabbit pAb

A13844-100ul 100 ul
EUR 308

NOXA1 Rabbit pAb

A13844-200ul 200 ul
EUR 459

NOXA1 Rabbit pAb

A13844-20ul 20 ul
EUR 183

NOXA1 Rabbit pAb

A13844-50ul 50 ul
EUR 223

NOXA1 Polyclonal Conjugated Antibody

C28378 100ul
EUR 397

NOXA1 Antibody

1-CSB-PA015963LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOXA1. Recognizes NOXA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Polyclonal NOXA1 Antibody (C-term)

APR10900G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOXA1 (C-term). This antibody is tested and proven to work in the following applications:

Noxa1/ Rat Noxa1 ELISA Kit

ELI-36921r 96 Tests
EUR 886

Anti-NOXA1 Antibody

PA1930 100ug/vial
EUR 294

Anti-NOXA1 antibody

STJ115784 100 µl
EUR 277
Description: This gene encodes a protein which activates NADPH oxidases, enzymes which catalyze a reaction generating reactive oxygen species. The encoded protein contains four N-terminal tetratricopeptide domains and a C-terminal Src homology 3 domain. Interaction between the encoded protein and proteins in the oxidase regulatory complex occur via the tetratricopeptide domains. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-NOXA1 antibody

STJ193133 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NOXA1

NOXA1 siRNA

20-abx903612
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOXA1 siRNA

20-abx926194
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOXA1 siRNA

20-abx926195
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-NOXA1

YF-PA17231 50 ug
EUR 363
Description: Mouse polyclonal to NOXA1

anti-NOXA1

YF-PA17232 100 ul
EUR 403
Description: Rabbit polyclonal to NOXA1

anti-NOXA1

YF-PA17233 100 ug
EUR 403
Description: Rabbit polyclonal to NOXA1

NOXA1 Antibody, HRP conjugated

1-CSB-PA015963LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOXA1. Recognizes NOXA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NOXA1 Antibody, FITC conjugated

1-CSB-PA015963LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOXA1. Recognizes NOXA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NOXA1 Antibody, Biotin conjugated

1-CSB-PA015963LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOXA1. Recognizes NOXA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NOXA1 cloning plasmid

CSB-CL015963HU-10ug 10ug
EUR 516
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1452
  • Sequence: atggcctctctgggggacctggtgcgcgcctggcacctgggcgcgcaggctgtggatcgtggggactgggcccgcgccttgcacctcttctcgggcgtcccggcgccgcccgccaggctgtgcttcaacgcgggctgcgtgcacctgctggccggggaccccgaggccgcgctgc
  • Show more
Description: A cloning plasmid for the NOXA1 gene.

NOXA1 ELISA KIT|Human

EF005325 96 Tests
EUR 689

Rat NOXA1 shRNA Plasmid

20-abx989691
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NOXA1 shRNA Plasmid

20-abx957370
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NOXA1 shRNA Plasmid

20-abx982506
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NOXA1 Recombinant Protein (Human)

RP021502 100 ug Ask for price

NOXA1 Recombinant Protein (Mouse)

RP154640 100 ug Ask for price

NOXA1 Recombinant Protein (Mouse)

RP154643 100 ug Ask for price

NOXA1 Recombinant Protein (Rat)

RP214277 100 ug Ask for price

NADPH Oxidase Activator 1 (NOXA1) Antibody

abx122122-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

NADPH Oxidase Activator 1 (NOXA1) Antibody

abx034428-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

NADPH Oxidase Activator 1 (NOXA1) Antibody

abx034428-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

NADPH Oxidase Activator 1 (NOXA1) Antibody

20-abx318700
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase Activator 1 (NOXA1) Antibody (HRP)

20-abx312958
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase Activator 1 (NOXA1) Antibody (FITC)

20-abx312959
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase Activator 1 (NOXA1) Antibody (Biotin)

20-abx312960
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Noxa1 ORF Vector (Rat) (pORF)

ORF071427 1.0 ug DNA
EUR 506

NOXA1 ORF Vector (Human) (pORF)

ORF007168 1.0 ug DNA
EUR 95

Noxa1 ORF Vector (Mouse) (pORF)

ORF051548 1.0 ug DNA
EUR 506

Noxa1 ORF Vector (Mouse) (pORF)

ORF051549 1.0 ug DNA
EUR 506

Noxa1 sgRNA CRISPR Lentivector set (Rat)

K6254801 3 x 1.0 ug
EUR 339

Noxa1 sgRNA CRISPR Lentivector set (Mouse)

K3586301 3 x 1.0 ug
EUR 339

NOXA1 sgRNA CRISPR Lentivector set (Human)

K1443401 3 x 1.0 ug
EUR 339

Noxa1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6254802 1.0 ug DNA
EUR 154

Noxa1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6254803 1.0 ug DNA
EUR 154

NOXA1 Rabbit Polyclonal Antibody