DLL4 Rabbit Polyclonal Antibody

DLL4 Rabbit Polyclonal Antibody

Contact Us Below To Order :

DLL4 Polyclonal Antibody

ES11956-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DLL4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DLL4 Rabbit pAb

A12943-100ul 100 ul
EUR 308

DLL4 Rabbit pAb

A12943-200ul 200 ul
EUR 459

DLL4 Rabbit pAb

A12943-20ul 20 ul
EUR 183

DLL4 Rabbit pAb

A12943-50ul 50 ul
EUR 223

Human Delta Like Protein 4 (dLL4) ELISA Kit

DLR-dLL4-Hu-48T 48T
EUR 517
  • Should the Human Delta Like Protein 4 (dLL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Delta Like Protein 4 (dLL4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Delta Like Protein 4 (dLL4) ELISA Kit

DLR-dLL4-Hu-96T 96T
EUR 673
  • Should the Human Delta Like Protein 4 (dLL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Delta Like Protein 4 (dLL4) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Delta Like Protein 4 (dLL4) ELISA Kit

DLR-dLL4-Ra-48T 48T
EUR 549
  • Should the Rat Delta Like Protein 4 (dLL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Delta Like Protein 4 (dLL4) in samples from tissue homogenates or other biological fluids.

Rat Delta Like Protein 4 (dLL4) ELISA Kit

DLR-dLL4-Ra-96T 96T
EUR 718
  • Should the Rat Delta Like Protein 4 (dLL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Delta Like Protein 4 (dLL4) in samples from tissue homogenates or other biological fluids.

Human Delta Like Protein 4 (dLL4) ELISA Kit

RDR-dLL4-Hu-48Tests 48 Tests
EUR 544

Human Delta Like Protein 4 (dLL4) ELISA Kit

RDR-dLL4-Hu-96Tests 96 Tests
EUR 756

Rat Delta Like Protein 4 (dLL4) ELISA Kit

RDR-dLL4-Ra-48Tests 48 Tests
EUR 583

Rat Delta Like Protein 4 (dLL4) ELISA Kit

RDR-dLL4-Ra-96Tests 96 Tests
EUR 811

Human Delta Like Protein 4 (dLL4) ELISA Kit

RD-dLL4-Hu-48Tests 48 Tests
EUR 521

Human Delta Like Protein 4 (dLL4) ELISA Kit

RD-dLL4-Hu-96Tests 96 Tests
EUR 723

Rat Delta Like Protein 4 (dLL4) ELISA Kit

RD-dLL4-Ra-48Tests 48 Tests
EUR 557

Rat Delta Like Protein 4 (dLL4) ELISA Kit

RD-dLL4-Ra-96Tests 96 Tests
EUR 775

Polyclonal DLL4 Antibody (C-term)

APR11755G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DLL4 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal DLL4 Antibody (internal region)

APR11756G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DLL4 (internal region). This antibody is tested and proven to work in the following applications:

DLL4 Antibody

36418-100ul 100ul
EUR 252

DLL4 Antibody

1-CSB-PA831848
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

DLL4 Antibody

1-CSB-PA073786
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

DLL4 Antibody

1-CSB-PA006949LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

DLL4 antibody

70R-6608 50 ug
EUR 467
Description: Rabbit polyclonal DLL4 antibody

DLL4 antibody

70R-6414 50 ug
EUR 467
Description: Rabbit polyclonal DLL4 antibody

DLL4 Antibody

BF0366 200ul
EUR 376
Description: DLL4 antibody detects endogenous levels of total DLL4.

Anti-DLL4 Antibody

A00875-1 100ug/vial
EUR 294

DLL4 Conjugated Antibody

C36418 100ul
EUR 397

anti- DLL4 antibody

FNab02416 100µg
EUR 585
  • Immunogen: delta-like 4(Drosophila)
  • Uniprot ID: Q9NR61
  • Gene ID: 54567
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Developmental biology, Stem Cells, Cell Division and Proliferation
Description: Antibody raised against DLL4

Anti-DLL4 antibody

PAab02416 100 ug
EUR 412

Anti-DLL4 antibody

STJ114809 100 µl
EUR 277
Description: This gene is a homolog of the Drosophila delta gene. The delta gene family encodes Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain.

Anti-DLL4 antibody

STJ193114 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DLL4

Anti-DLL4 antibody

STJ71295 100 µg
EUR 359

DLL4 protein

80R-4332 50 ug
EUR 327
Description: Purified Recombinant DLL4 protein (His tagged)

DLL4 siRNA

20-abx914242
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DLL4 siRNA

20-abx914243
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DLL4

YF-PA26263 50 ul
EUR 334
Description: Mouse polyclonal to DLL4

DLL4 Antibody, HRP conjugated

1-CSB-PA006949LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DLL4 Antibody, FITC conjugated

1-CSB-PA006949LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DLL4 Antibody, Biotin conjugated

1-CSB-PA006949LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat)

4-PAJ256Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly214~Ser330)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4)

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat)

4-PAJ256Ra02
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly215~Ser331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4)

DLL4 Blocking Peptide

33R-7121 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DLL4 antibody, catalog no. 70R-6414

DLL4 Blocking Peptide

33R-7573 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DLL4 antibody, catalog no. 70R-6608

Anti-DLL4 Purified

11-717-C025 0.025 mg
EUR 86

Anti-DLL4 Purified

11-717-C100 0.1 mg
EUR 131

DLL4 Blocking Peptide

BF0366-BP 1mg
EUR 195

DLL4 cloning plasmid

CSB-CL878862HU-10ug 10ug
EUR 686
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2058
  • Sequence: ATGGCGGCAGCGTCCCGGAGCGCCTCTGGCTGGGCGCTACTGCTGCTGGTGGCACTTTGGCAGCAGCGCGCGGCCGGCTCCGGCGTCTTCCAGCTGCAGCTGCAGGAGTTCATCAACGAGCGCGGCGTACTGGCCAGTGGGCGGCCTTGCGAGCCCGGCTGCCGGACTTTCTTCC
  • Show more
Description: A cloning plasmid for the DLL4 gene.

anti-DLL4 (4A11)

LF-MA30736 100 ul
EUR 527
Description: Mouse Monoclonal to DLL4

anti-DLL4 (4A11)

LF-MA30749 100 ul
EUR 527
Description: Mouse Monoclonal to DLL4

Anti-DLL4 (2E2)

YF-MA11544 100 ug
EUR 363
Description: Mouse monoclonal to DLL4

Monoclonal DLL4 Antibody, Clone: 4A11

APR11754G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human DLL4. The antibodies are raised in Mouse and are from clone 4A11. This antibody is applicable in WB, FC, E

Monoclonal DLL4 Antibody, Clone: 4A11F8

AMM02902G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human DLL4. The antibodies are raised in Mouse and are from clone 4A11F8. This antibody is applicable in WB and IHC, E

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), APC

4-PAJ256Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly214~Ser330)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with APC.

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), Biotinylated

4-PAJ256Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly214~Ser330)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with Biotin.

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), Cy3

4-PAJ256Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly214~Ser330)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with Cy3.

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), FITC

4-PAJ256Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly214~Ser330)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with FITC.

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), HRP

4-PAJ256Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly214~Ser330)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with HRP.

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), PE

4-PAJ256Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly214~Ser330)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with PE.

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), APC

4-PAJ256Ra02-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly215~Ser331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with APC.

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), Biotinylated

4-PAJ256Ra02-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly215~Ser331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with Biotin.

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), Cy3

4-PAJ256Ra02-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly215~Ser331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with Cy3.

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), FITC

4-PAJ256Ra02-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly215~Ser331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with FITC.

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), HRP

4-PAJ256Ra02-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly215~Ser331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with HRP.

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), PE

4-PAJ256Ra02-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly215~Ser331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with PE.

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), APC-Cy7

4-PAJ256Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly214~Ser330)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with APC-Cy7.

Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), APC-Cy7

4-PAJ256Ra02-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: dLL4 (Gly215~Ser331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with APC-Cy7.

Delta Like Protein 4 (DLL4) Antibody

abx015837-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Delta Like Protein 4 (dLL4) Antibody

20-abx176138
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Delta Like Protein 4 (DLL4) Antibody

20-abx212394
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Delta Like Protein 4 (DLL4) Antibody

20-abx212866
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Delta Like Protein 4 (dLL4) Antibody

20-abx102012
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Delta Like Protein 4 (DLL4) Antibody

20-abx124017
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Delta Like Protein 4 (DLL4) Antibody

abx037133-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Delta Like Protein 4 (dLL4) Antibody

20-abx130019
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Delta Like Protein 4 (DLL4) Antibody

abx140132-01mg 0.1 mg
EUR 314
  • Shipped within 5-12 working days.

Delta Like Protein 4 (DLL4) Antibody

abx140133-01mg 0.1 mg
EUR 314
  • Shipped within 5-12 working days.

Delta Like Protein 4 (dLL4) Antibody

20-abx172082
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Delta Like Protein 4 (DLL4) Antibody

abx012164-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Delta Like Protein 4 (DLL4) Antibody

abx034592-400ul 400 ul
EUR 551
  • Shipped within 5-10 working days.

Delta Like Protein 4 (DLL4) Antibody

abx034592-80l 80 µl
EUR 321
  • Shipped within 5-10 working days.

Delta-Like Protein 4 (DLL4) Antibody

20-abx318069
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Delta Like Protein 4 (DLL4) Antibody

abx432612-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Delta Like Protein 4 (DLL4) Antibody

abx232416-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

DLL4 ELISA KIT|Human

EF007299 96 Tests
EUR 689

Mouse DLL4 shRNA Plasmid

20-abx974507
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DLL4 shRNA Plasmid

20-abx960138
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Human DLL4 Protein

RP00356 10 μg
EUR 174

DLL4 Recombinant Protein (Human)

RP038542 100 ug Ask for price

DLL4 Recombinant Protein (Rat)

RP198176 100 ug Ask for price

DLL4 Recombinant Protein (Mouse)

RP129269 100 ug Ask for price

Delta Like Protein 4 (dLL4) Antibody (Biotin)

20-abx273304
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Delta-Like Protein 4 (DLL4) Antibody (HRP)

20-abx315231
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Delta-Like Protein 4 (DLL4) Antibody (FITC)

20-abx315232
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Delta-Like Protein 4 (DLL4) Antibody (Biotin)

20-abx315233
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Delta Like Protein 4 (DLL4) Antibody (RPE)

abx415140-100tests 100 tests
EUR 592
  • Shipped within 1 week.

Anti-DLL4 Purified Low Endotoxin

12-717-C100 0.1 mg
EUR 131

ELISA kit for Mouse DLL4

EK5567 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse DLL4 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat DLL4

EK5747 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat DLL4 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse DLL4 PicoKine ELISA Kit

EK1277 96 wells
EUR 425
Description: For quantitative detection of mouse DLL4 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Rat DLL4 PicoKine ELISA Kit

EK1570 96 wells
EUR 425
Description: For quantitative detection of rat DLL4 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Anti-DLL4 -SMCC-DM1 ADC

ADC-W-1022 1mg Ask for price
Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a SMCC linker to DM1

Anti-DLL4 -SPDB-DM4 ADC

ADC-W-1023 1mg Ask for price
Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a SPDB linker to DM4

Anti-DLL4 -MC-MMAF ADC

ADC-W-1024 1mg Ask for price
Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a MC linker to MMAF

Human CellExp? DLL4, Mouse Recombinant

P1163-10
EUR 207

Human CellExp? DLL4, Mouse Recombinant

P1163-50
EUR 675

Dll4 ORF Vector (Rat) (pORF)

ORF066060 1.0 ug DNA
EUR 506

DLL4 ORF Vector (Human) (pORF)

ORF012848 1.0 ug DNA
EUR 354

Dll4 ORF Vector (Mouse) (pORF)

ORF043091 1.0 ug DNA
EUR 506

Anti-DLL4 (Demcizumab)-SMCC-DM1 ADC

ADC-W-1016 1mg Ask for price
Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a SMCC linker to DM1

Anti-DLL4 (Demcizumab)-SPDB-DM4 ADC

ADC-W-1017 1mg Ask for price
Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a SPDB linker to DM4

Anti-DLL4 (Demcizumab)-MC-MMAF ADC

ADC-W-1018 1mg Ask for price
Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a MC linker to MMAF

DLL4 sgRNA CRISPR Lentivector set (Human)

K0607901 3 x 1.0 ug
EUR 339

Dll4 sgRNA CRISPR Lentivector set (Rat)

K7535901 3 x 1.0 ug
EUR 339

Dll4 sgRNA CRISPR Lentivector set (Mouse)

K4427301 3 x 1.0 ug
EUR 339

DLL4 Delta-Like 4Mouse Recombinant Protein

PROTQ9JI71 Regular: 10ug
EUR 317
Description: DLL4 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (27-532 a.a.) and fused to a 6 aa His Tag at C-terminus containing a total of 512 amino acids and having a molecular mass of 55.8kDa.;DLL4 shows multiple bands between 50-70kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques.

Recombinant Delta Like Protein 4 (dLL4)

4-RPJ256Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9NR61
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Delta Like Protein 4 expressed in: E.coli

Recombinant Delta Like Protein 4 (dLL4)

4-RPJ256Ra01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZHH1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Delta Like Protein 4 expressed in: E.coli

Recombinant Delta Like Protein 4 (dLL4)

4-RPJ256Ra02
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZHH1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 39.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Delta Like Protein 4 expressed in: E.coli

Rat Delta Like Protein 4 (dLL4) Protein

20-abx066300
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Delta Like Protein 4 (dLL4) Protein

20-abx066301
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Anti-DLL4 -MC-Vc-PAB-MMAE ADC

ADC-W-1025 1mg Ask for price
Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a MC-Vc linker to MMAE

Anti-DLL4 -MC-Vc-PAB-SN38 ADC

ADC-W-1026 1mg Ask for price
Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a MC-Vc-PAB linker to SN38

Human Delta Like Protein 4 (dLL4) Protein

20-abx652251
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

DLL4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0607902 1.0 ug DNA
EUR 154

DLL4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0607903 1.0 ug DNA
EUR 154

DLL4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0607904 1.0 ug DNA
EUR 154

Dll4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7535902 1.0 ug DNA
EUR 154

Dll4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7535903 1.0 ug DNA
EUR 154

Dll4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7535904 1.0 ug DNA
EUR 154

Dll4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4427302 1.0 ug DNA
EUR 154

Dll4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4427303 1.0 ug DNA
EUR 154

Dll4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4427304 1.0 ug DNA
EUR 154

DLL4 Protein Vector (Mouse) (pPB-C-His)

PV172362 500 ng
EUR 1065

DLL4 Protein Vector (Mouse) (pPB-N-His)

PV172363 500 ng
EUR 1065

DLL4 Protein Vector (Mouse) (pPM-C-HA)

PV172364 500 ng
EUR 1065

DLL4 Protein Vector (Mouse) (pPM-C-His)

PV172365 500 ng
EUR 1065

DLL4 Protein Vector (Rat) (pPB-C-His)

PV264238 500 ng
EUR 1166

DLL4 Protein Vector (Rat) (pPB-N-His)

PV264239 500 ng
EUR 1166

DLL4 Protein Vector (Rat) (pPM-C-HA)

PV264240 500 ng
EUR 1166

DLL4 Protein Vector (Rat) (pPM-C-His)

PV264241 500 ng
EUR 1166

DLL4 Protein Vector (Human) (pPB-C-His)

PV051389 500 ng
EUR 481

DLL4 Protein Vector (Human) (pPB-N-His)

PV051390 500 ng
EUR 481

DLL4 Protein Vector (Human) (pPM-C-HA)

PV051391 500 ng
EUR 481

DLL4 Protein Vector (Human) (pPM-C-His)

PV051392 500 ng
EUR 481

Recombinant Mouse DLL4 Protein, His, Insect-10ug

QP11670-10ug 10ug
EUR 201

Recombinant Mouse DLL4 Protein, His, Insect-1mg

QP11670-1mg 1mg
EUR 5251

Recombinant Mouse DLL4 Protein, His, Insect-2ug

QP11670-2ug 2ug
EUR 155

Dll4 3'UTR GFP Stable Cell Line

TU155193 1.0 ml Ask for price

Dll4 3'UTR Luciferase Stable Cell Line

TU105193 1.0 ml Ask for price

Dll4 3'UTR Luciferase Stable Cell Line

TU203456 1.0 ml Ask for price

Dll4 3'UTR GFP Stable Cell Line

TU253456 1.0 ml Ask for price

DLL4 3'UTR GFP Stable Cell Line

TU056071 1.0 ml
EUR 1394

DLL4 3'UTR Luciferase Stable Cell Line

TU006071 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody

ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody

ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody

ABP57575-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody

ABP57576-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody

ABP57576-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody

ABP57576-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody

ABP57577-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody

ABP57577-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody

ABP57577-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody

ABP57578-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody

ABP57578-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody

ABP57578-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody

ABP57579-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody

ABP57579-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody

ABP57579-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

DLL4 Rabbit Polyclonal Antibody