WFS1 Rabbit Polyclonal Antibody

WFS1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    WFS1 Polyclonal Antibody
    ES11949-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against WFS1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    WFS1 Polyclonal Antibody
    ES11949-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against WFS1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    WFS1 Rabbit pAb
    A1705-100ul 100 ul
    EUR 308
    WFS1 Rabbit pAb
    A1705-200ul 200 ul
    EUR 459
    WFS1 Rabbit pAb
    A1705-20ul 20 ul
    EUR 183
    WFS1 Rabbit pAb
    A1705-50ul 50 ul
    EUR 223
    Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    DLR-WFS1-Hu-48T 48T
    EUR 554
    • Should the Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.
    Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    DLR-WFS1-Hu-96T 96T
    EUR 725
    • Should the Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.
    Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    DLR-WFS1-Mu-48T 48T
    EUR 566
    • Should the Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.
    Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    DLR-WFS1-Mu-96T 96T
    EUR 741
    • Should the Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.
    Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    DLR-WFS1-Ra-48T 48T
    EUR 590
    • Should the Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.
    Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    DLR-WFS1-Ra-96T 96T
    EUR 774
    • Should the Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Wolfram Syndrome Protein 1 (WFS1) in samples from tissue homogenates or other biological fluids.
    Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RDR-WFS1-Hu-48Tests 48 Tests
    EUR 589
    Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RDR-WFS1-Hu-96Tests 96 Tests
    EUR 820
    Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RDR-WFS1-Mu-48Tests 48 Tests
    EUR 603
    Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RDR-WFS1-Mu-96Tests 96 Tests
    EUR 840
    Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RDR-WFS1-Ra-48Tests 48 Tests
    EUR 631
    Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RDR-WFS1-Ra-96Tests 96 Tests
    EUR 880
    Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RD-WFS1-Hu-48Tests 48 Tests
    EUR 563
    Human Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RD-WFS1-Hu-96Tests 96 Tests
    EUR 783
    Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RD-WFS1-Mu-48Tests 48 Tests
    EUR 577
    Mouse Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RD-WFS1-Mu-96Tests 96 Tests
    EUR 802
    Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RD-WFS1-Ra-48Tests 48 Tests
    EUR 603
    Rat Wolfram Syndrome Protein 1 (WFS1) ELISA Kit
    RD-WFS1-Ra-96Tests 96 Tests
    EUR 840
    WFS1 antibody
    70R-21319 50 ul
    EUR 435
    Description: Rabbit polyclonal WFS1 antibody
    WFS1 antibody
    38285-100ul 100ul
    EUR 252
    WFS1 Antibody
    43590-100ul 100ul
    EUR 252
    WFS1 Antibody
    DF6566 200ul
    EUR 304
    Description: WFS1 Antibody detects endogenous levels of total WFS1.
    WFS1 Antibody
    1-CSB-PA026100GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against WFS1. Recognizes WFS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
    WFS1 antibody
    70R-50550 100 ul
    EUR 244
    Description: Purified Polyclonal WFS1 antibody
    WFS1 Antibody
    ABD6566 100 ug
    EUR 438
    Polyclonal WFS1 Antibody (aa183-232)
    APR10738G 0.05ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WFS1 (aa183-232). This antibody is tested and proven to work in the following applications:
    Wolframin (WFS1) Antibody
    20-abx008572
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.
    Wolframin (WFS1) Antibody
    abx036709-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Wolframin (WFS1) Antibody
    abx239509-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    WFS1 Conjugated Antibody
    C43590 100ul
    EUR 397
    Wolframin (WFS1) Antibody
    20-abx001429
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    anti- WFS1 antibody
    FNab09509 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:200-1:2000
    • IHC: 1:50-1:500
    • IF: 1:50-1:200
    • Immunogen: Wolfram syndrome 1(wolframin)
    • Uniprot ID: O76024
    • Gene ID: 7466
    • Research Area: Neuroscience
    Description: Antibody raised against WFS1
    Anti-WFS1 antibody
    PAab09509 100 ug
    EUR 386
    Anti-WFS1 antibody
    STJ26110 100 µl
    EUR 277
    Description: This gene encodes a transmembrane protein, which is located primarily in the endoplasmic reticulum and ubiquitously expressed with highest levels in brain, pancreas, heart, and insulinoma beta-cell lines. Mutations in this gene are associated with Wolfram syndrome, also called DIDMOAD (Diabetes Insipidus, Diabetes Mellitus, Optic Atrophy, and Deafness), an autosomal recessive disorder. The disease affects the brain and central nervous system. Mutations in this gene can also cause autosomal dominant deafness 6 (DFNA6), also known as DFNA14 or DFNA38. Alternatively spliced transcript variants have been found for this gene.
    Anti-WFS1 antibody
    STJ193107 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to WFS1
    WFS1 siRNA
    20-abx939839
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    WFS1 siRNA
    20-abx939840
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    WFS1 Blocking Peptide
    DF6566-BP 1mg
    EUR 195
    WFS1 Blocking Peptide
    20-abx063425
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.
    WFS1 cloning plasmid
    CSB-CL026100HU-10ug 10ug
    EUR 558
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2673
    • Sequence: atggactccaacactgctccgctgggcccctcctgcccacagcccccgccagcaccgcagccccaggcgcgttcccgactcaatgccacagcctcgttggagcaggagaggagcgaaaggccccgagcacccggaccccaggctggccctggccctggtgttagagacgcagcgg
    • Show more
    Description: A cloning plasmid for the WFS1 gene.
    Recombinant human WFS1
    P1940 100ug Ask for price
    • Uniprot ID: O76024
    • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
    Description: Recombinant protein for human WFS1
    Wolfram Syndrome Protein 1 (WFS1) Antibody
    20-abx178933
    • EUR 1316.00
    • EUR 620.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Wolfram Syndrome Protein 1 (WFS1) Antibody
    20-abx178934
    • EUR 1344.00
    • EUR 634.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Wolfram Syndrome Protein 1 (WFS1) Antibody
    20-abx178935
    • EUR 1344.00
    • EUR 634.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Wolfram Syndrome Protein 1 (WFS1) Antibody
    20-abx178936
    • EUR 1414.00
    • EUR 662.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Wolfram Syndrome Protein 1 (WFS1) Antibody
    20-abx175148
    • EUR 926.00
    • EUR 467.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Wolfram Syndrome Protein 1 (WFS1) Antibody
    20-abx175149
    • EUR 982.00
    • EUR 495.00
    • 1 mg
    • 200 ug
    • Please enquire.
    WFS1 ELISA KIT|Human
    EF004293 96 Tests
    EUR 689
    Mouse WFS1 shRNA Plasmid
    20-abx973394
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human WFS1 shRNA Plasmid
    20-abx955107
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human Wolframin, WFS1 ELISA KIT
    ELI-14964h 96 Tests
    EUR 824
    Mouse Wolframin, Wfs1 ELISA KIT
    ELI-40468m 96 Tests
    EUR 865
    Wfs1 ORF Vector (Mouse) (pORF)
    ORF061844 1.0 ug DNA
    EUR 506
    Wfs1 ORF Vector (Rat) (pORF)
    ORF079137 1.0 ug DNA
    EUR 506
    WFS1 ORF Vector (Human) (pORF)
    ORF011595 1.0 ug DNA
    EUR 95
    WFS1 ELISA Kit (Human) (OKCD02035)
    OKCD02035 96 Wells
    EUR 909
    Description: Description of target: Participates in the regulation of cellular Ca2+ homeostasis, at least partly, by modulating the filling state of the endoplasmic reticulum Ca2+ store.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.103 ng/mL
    Wfs1 ELISA Kit (Mouse) (OKCD02036)
    OKCD02036 96 Wells
    EUR 936
    Description: Description of target: Participates in the regulation of cellular Ca2+ homeostasis, at least partly, by modulating the filling state of the endoplasmic reticulum Ca2+ store.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.133 ng/mL
    WFS1 ELISA Kit (Rat) (OKCD09279)
    OKCD09279 96 Wells
    EUR 1157
    Description: Description of target: endoplasmic reticulum membrane glycoprotein; postulated to be involved in neuronal membrane trafficking or protein processing.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.118ng/mL
    Wfs1 sgRNA CRISPR Lentivector set (Mouse)
    K4992301 3 x 1.0 ug
    EUR 339
    ELISA kit for Mouse Wolframin (WFS1)
    KTE70013-48T 48T
    EUR 332
    • Human WHDC1 expressed in insect cells had an apparent molecular mass of about 100 kD by SDS-PAGE. Western blot analysis detected WHDC1 in most human and mouse organs examined, with highest expression in brain. WHDC1 was also expressed in all cultured
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Wolframin (WFS1)
    KTE70013-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Human WHDC1 expressed in insect cells had an apparent molecular mass of about 100 kD by SDS-PAGE. Western blot analysis detected WHDC1 in most human and mouse organs examined, with highest expression in brain. WHDC1 was also expressed in all cultured
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Wolframin (WFS1)
    KTE70013-96T 96T
    EUR 539
    • Human WHDC1 expressed in insect cells had an apparent molecular mass of about 100 kD by SDS-PAGE. Western blot analysis detected WHDC1 in most human and mouse organs examined, with highest expression in brain. WHDC1 was also expressed in all cultured
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Wfs1 sgRNA CRISPR Lentivector set (Rat)
    K6999601 3 x 1.0 ug
    EUR 339
    WFS1 sgRNA CRISPR Lentivector set (Human)
    K2638801 3 x 1.0 ug
    EUR 339
    ELISA kit for Human Wolframin (WFS1)
    KTE60034-48T 48T
    EUR 332
    • Wolframin is a transmembrane protein.Wolframin appears to function as a cation-selective ion channel.Mutations in this gene are associated with an autosomal recessive syndrome characterized by insulin-dependent diabetes mellitus and bilateral progres
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Wolframin (WFS1)
    KTE60034-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Wolframin is a transmembrane protein.Wolframin appears to function as a cation-selective ion channel.Mutations in this gene are associated with an autosomal recessive syndrome characterized by insulin-dependent diabetes mellitus and bilateral progres
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Wolframin (WFS1)
    KTE60034-96T 96T
    EUR 539
    • Wolframin is a transmembrane protein.Wolframin appears to function as a cation-selective ion channel.Mutations in this gene are associated with an autosomal recessive syndrome characterized by insulin-dependent diabetes mellitus and bilateral progres
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Wolframin (WFS1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Human Wolfram Syndrome Protein 1 (WFS1) Protein
    20-abx655526
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Mouse Wolfram Syndrome Protein 1 (WFS1) Protein
    20-abx655527
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Mouse Wolfram Syndrome Protein 1 (WFS1) Protein
    20-abx655528
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Rat Wolfram Syndrome Protein 1 (WFS1) Protein
    20-abx655529
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Wfs1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4992302 1.0 ug DNA
    EUR 154
    Wfs1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4992303 1.0 ug DNA
    EUR 154
    Wfs1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4992304 1.0 ug DNA
    EUR 154
    Wfs1 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6999602 1.0 ug DNA
    EUR 154
    Wfs1 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6999603 1.0 ug DNA
    EUR 154
    Wfs1 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6999604 1.0 ug DNA
    EUR 154
    WFS1 sgRNA CRISPR Lentivector (Human) (Target 1)
    K2638802 1.0 ug DNA
    EUR 154
    WFS1 sgRNA CRISPR Lentivector (Human) (Target 2)
    K2638803 1.0 ug DNA
    EUR 154
    WFS1 sgRNA CRISPR Lentivector (Human) (Target 3)
    K2638804 1.0 ug DNA
    EUR 154
    WFS1 Protein Vector (Mouse) (pPB-C-His)
    PV247374 500 ng
    EUR 1065
    WFS1 Protein Vector (Mouse) (pPB-N-His)
    PV247375 500 ng
    EUR 1065
    WFS1 Protein Vector (Mouse) (pPM-C-HA)
    PV247376 500 ng
    EUR 1065
    WFS1 Protein Vector (Mouse) (pPM-C-His)
    PV247377 500 ng
    EUR 1065
    WFS1 Protein Vector (Rat) (pPB-C-His)
    PV316546 500 ng
    EUR 1166
    WFS1 Protein Vector (Rat) (pPB-N-His)
    PV316547 500 ng
    EUR 1166
    WFS1 Protein Vector (Rat) (pPM-C-HA)
    PV316548 500 ng
    EUR 1166
    WFS1 Protein Vector (Rat) (pPM-C-His)
    PV316549 500 ng
    EUR 1166
    WFS1 Protein Vector (Human) (pPB-C-His)
    PV046377 500 ng
    EUR 329
    WFS1 Protein Vector (Human) (pPB-N-His)
    PV046378 500 ng
    EUR 329
    WFS1 Protein Vector (Human) (pPM-C-HA)
    PV046379 500 ng
    EUR 329
    WFS1 Protein Vector (Human) (pPM-C-His)
    PV046380 500 ng
    EUR 329
    Wfs1 3'UTR Luciferase Stable Cell Line
    TU122299 1.0 ml Ask for price
    WFS1 3'UTR GFP Stable Cell Line
    TU078483 1.0 ml
    EUR 1394
    Wfs1 3'UTR GFP Stable Cell Line
    TU172299 1.0 ml Ask for price
    Wfs1 3'UTR Luciferase Stable Cell Line
    TU223400 1.0 ml Ask for price
    WFS1 3'UTR Luciferase Stable Cell Line
    TU028483 1.0 ml
    EUR 1394
    Wfs1 3'UTR GFP Stable Cell Line
    TU273400 1.0 ml Ask for price
    WFS1 Chemi-Luminescent ELISA Kit (Rat) (OKCD04028)
    OKCD04028 96 Wells
    EUR 1066
    Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL
    WFS1 Chemi-Luminescent ELISA Kit (Human) (OKCD04029)
    OKCD04029 96 Wells
    EUR 988
    Description: Description of target: Participates in the regulation of cellular Ca2+ homeostasis, at least partly, by modulating the filling state of the endoplasmic reticulum Ca2+ store.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL
    WFS1 Chemi-Luminescent ELISA Kit (Mouse) (OKCD04030)
    OKCD04030 96 Wells
    EUR 1027
    Description: Description of target: Participates in the regulation of cellular Ca2+ homeostasis, at least partly, by modulating the filling state of the endoplasmic reticulum Ca2+ store.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL
    GAPDH Rabbit Polyclonal Antibody
    37985-100ul 100ul
    EUR 252
    GAPDH Rabbit Polyclonal Antibody
    37985-50ul 50ul
    EUR 187
    EFHD1 Rabbit Polyclonal Antibody
    38001-100ul 100ul
    EUR 252
    EFHD1 Rabbit Polyclonal Antibody
    38001-50ul 50ul
    EUR 187
    Alliinase Rabbit Polyclonal Antibody
    38042-100ul 100ul
    EUR 252
    Alliinase Rabbit Polyclonal Antibody
    38042-50ul 50ul
    EUR 187
    ECFP Rabbit Polyclonal Antibody
    38077-100ul 100ul
    EUR 252
    ECFP Rabbit Polyclonal Antibody
    38077-50ul 50ul
    EUR 187
    EYFP Rabbit Polyclonal Antibody
    38078-100ul 100ul
    EUR 252
    EYFP Rabbit Polyclonal Antibody
    38078-50ul 50ul
    EUR 187
    mOrange Rabbit Polyclonal Antibody
    38079-100ul 100ul
    EUR 252
    mOrange Rabbit Polyclonal Antibody
    38079-50ul 50ul
    EUR 187
    mStrawberry Rabbit Polyclonal Antibody
    38083-100ul 100ul
    EUR 252
    mStrawberry Rabbit Polyclonal Antibody
    38083-50ul 50ul
    EUR 187
    AmCyan Rabbit Polyclonal Antibody
    38086-100ul 100ul
    EUR 252
    AmCyan Rabbit Polyclonal Antibody
    38086-50ul 50ul
    EUR 187
    EBFP Rabbit Polyclonal Antibody
    38087-100ul 100ul
    EUR 252
    EBFP Rabbit Polyclonal Antibody
    38087-50ul 50ul
    EUR 187
    Vimentin Rabbit Polyclonal Antibody
    38104-100ul 100ul
    EUR 252
    Vimentin Rabbit Polyclonal Antibody
    38104-50ul 50ul
    EUR 187
    LDHD Rabbit Polyclonal Antibody
    38105-100ul 100ul
    EUR 252
    LDHD Rabbit Polyclonal Antibody
    38105-50ul 50ul
    EUR 187
    GAPDH Rabbit Polyclonal Antibody
    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    Rabbit Hemoglobin Polyclonal Antibody
    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products
    Met Rabbit Polyclonal Antibody
    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    VEGF Rabbit Polyclonal Antibody
    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    CD10 Rabbit Polyclonal Antibody
    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    NM23A Rabbit Polyclonal Antibody
    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    ATM Rabbit Polyclonal Antibody
    ABP57463-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57463-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57463-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    JAK1 Rabbit Polyclonal Antibody
    ABP57569-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
    JAK1 Rabbit Polyclonal Antibody
    ABP57569-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
    JAK1 Rabbit Polyclonal Antibody
    ABP57569-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
    JAK2 Rabbit Polyclonal Antibody
    ABP57570-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
    JAK2 Rabbit Polyclonal Antibody
    ABP57570-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
    JAK2 Rabbit Polyclonal Antibody
    ABP57570-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
    JNK2 Rabbit Polyclonal Antibody
    ABP57571-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
    JNK2 Rabbit Polyclonal Antibody
    ABP57571-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
    JNK2 Rabbit Polyclonal Antibody
    ABP57571-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
    JNK3 Rabbit Polyclonal Antibody
    ABP57572-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
    JNK3 Rabbit Polyclonal Antibody
    ABP57572-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
    JNK3 Rabbit Polyclonal Antibody
    ABP57572-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
    MEK2 Rabbit Polyclonal Antibody
    ABP57573-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
    MEK2 Rabbit Polyclonal Antibody
    ABP57573-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
    MEK2 Rabbit Polyclonal Antibody
    ABP57573-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
    MEK3 Rabbit Polyclonal Antibody
    ABP57574-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
    MEK3 Rabbit Polyclonal Antibody
    ABP57574-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
    MEK3 Rabbit Polyclonal Antibody
    ABP57574-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
    Nrf2 Rabbit Polyclonal Antibody
    ABP57575-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
    Nrf2 Rabbit Polyclonal Antibody
    ABP57575-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
    Nrf2 Rabbit Polyclonal Antibody
    ABP57575-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
    ATG4a Rabbit Polyclonal Antibody
    ABP57576-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
    ATG4a Rabbit Polyclonal Antibody
    ABP57576-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
    ATG4a Rabbit Polyclonal Antibody
    ABP57576-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
    ATG4b Rabbit Polyclonal Antibody
    ABP57577-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
    ATG4b Rabbit Polyclonal Antibody
    ABP57577-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
    ATG4b Rabbit Polyclonal Antibody
    ABP57577-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
    ATG4c Rabbit Polyclonal Antibody
    ABP57578-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
    ATG4c Rabbit Polyclonal Antibody
    ABP57578-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
    ATG4c Rabbit Polyclonal Antibody
    ABP57578-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
    ATG5 Rabbit Polyclonal Antibody
    ABP57579-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5
    ATG5 Rabbit Polyclonal Antibody
    ABP57579-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5
    ATG5 Rabbit Polyclonal Antibody
    ABP57579-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5
    ATG7 Rabbit Polyclonal Antibody
    ABP57580-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

    WFS1 Rabbit Polyclonal Antibody