VPS11 Rabbit Polyclonal Antibody

VPS11 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    VPS11 Polyclonal Antibody
    ABP60900-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human VPS11 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of VPS11 from Human, Mouse. This VPS11 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VPS11 protein
    VPS11 Polyclonal Antibody
    ES11948-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VPS11 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    VPS11 Polyclonal Antibody
    ES11948-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VPS11 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    VPS11 antibody
    22313-100ul 100ul
    EUR 390
    VPS11 antibody
    70R-13100 100 ul
    EUR 457
    Description: Affinity purified Rabbit polyclonal VPS11 antibody
    VPS11 antibody
    70R-21262 50 ul
    EUR 435
    Description: Rabbit polyclonal VPS11 antibody
    VPS11 Antibody
    1-CSB-PA887959ESR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against VPS11. Recognizes VPS11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
    VPS11 Antibody
    1-CSB-PA887959ESR2HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against VPS11. Recognizes VPS11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
    VPS11 Antibody
    DF12500 200ul
    EUR 304
    Description: VPS11 antibody detects endogenous levels of VPS11.
    VPS11 Antibody
    1-CSB-PA025889GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against VPS11. Recognizes VPS11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
    Polyclonal VPS11 Antibody (internal region)
    AMM08468G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VPS11 (internal region). This antibody is tested and proven to work in the following applications:
    anti- VPS11 antibody
    FNab09426 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500-1:5000
    • IF: 1:10-1:100
    • IP: 1:200-1:2000
    • FC:N/A
    • Immunogen: vacuolar protein sorting 11 homolog(S. cerevisiae)
    • Uniprot ID: Q9H270
    • Gene ID: 55823
    • Research Area: Signal Transduction
    Description: Antibody raised against VPS11
    Anti-VPS11 antibody
    PAab09426 100 ug
    EUR 386
    Anti-VPS11 antibody
    STJ193106 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to VPS11
    Anti-VPS11 antibody
    STJ70733 100 µg
    EUR 359
    VPS11 siRNA
    20-abx939490
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    VPS11 siRNA
    20-abx939491
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    anti-VPS11
    YF-PA19866 50 ul
    EUR 363
    Description: Mouse polyclonal to VPS11
    anti-VPS11
    YF-PA26370 50 ul
    EUR 334
    Description: Mouse polyclonal to VPS11
    VPS11 Blocking Peptide
    DF12500-BP 1mg
    EUR 195
    VPS11 cloning plasmid
    CSB-CL887959HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 996
    • Sequence: atgagtgaagtgcagccagactcaccccaggggatctacgacacactccttgagctgcgactgcagaactgggcccacgagaaggatccacaggtcaaagagaagcttcacgcagaggccatttccctgctgaagagtggtcgcttctgtgacgtctttgacaaggccctggtcct
    • Show more
    Description: A cloning plasmid for the VPS11 gene.
    Anti-VPS11 (1H1)
    YF-MA11572 100 ug
    EUR 363
    Description: Mouse monoclonal to VPS11
    VPS11 ELISA KIT|Human
    EF004207 96 Tests
    EUR 689
    Mouse Vps11 ELISA KIT
    ELI-51416m 96 Tests
    EUR 865
    Mouse VPS11 shRNA Plasmid
    20-abx977482
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human VPS11 shRNA Plasmid
    20-abx960949
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human VPS11 ELISA KIT
    ELI-40616h 96 Tests
    EUR 824
    Monoclonal VPS11 Antibody (monoclonal) (M01), Clone: 1H1
    AMM08469G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human VPS11 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1H1. This antibody is applicable in WB
    Vps11 ORF Vector (Mouse) (pORF)
    ORF061625 1.0 ug DNA
    EUR 506
    Vps11 ORF Vector (Rat) (pORF)
    ORF078996 1.0 ug DNA
    EUR 506
    VPS11 ORF Vector (Human) (pORF)
    ORF011454 1.0 ug DNA
    EUR 95
    Vps11 sgRNA CRISPR Lentivector set (Rat)
    K6529801 3 x 1.0 ug
    EUR 339
    VPS11 sgRNA CRISPR Lentivector set (Human)
    K2617401 3 x 1.0 ug
    EUR 339
    Vps11 sgRNA CRISPR Lentivector set (Mouse)
    K3882101 3 x 1.0 ug
    EUR 339
    Vacuolar Protein Sorting-Associated Protein 11 Homolog (VPS11) Antibody
    abx028857-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Vacuolar Protein Sorting-Associated Protein 11 Homolog (VPS11) Antibody
    abx028857-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Vacuolar Protein Sorting-Associated Protein 11 Homolog (VPS11) Antibody
    abx239426-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    Vacuolar Protein Sorting-Associated Protein 11 Homolog (VPS11) Antibody
    20-abx321137
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Vacuolar Protein Sorting-Associated Protein 11 Homolog (VPS11) Antibody
    20-abx321138
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Vacuolar Protein Sorting-Associated Protein 11 Homolog (VPS11) Antibody
    abx432146-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.
    Vps11 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6529802 1.0 ug DNA
    EUR 154
    Vps11 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6529803 1.0 ug DNA
    EUR 154
    Vps11 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6529804 1.0 ug DNA
    EUR 154
    VPS11 sgRNA CRISPR Lentivector (Human) (Target 1)
    K2617402 1.0 ug DNA
    EUR 154
    VPS11 sgRNA CRISPR Lentivector (Human) (Target 2)
    K2617403 1.0 ug DNA
    EUR 154
    VPS11 sgRNA CRISPR Lentivector (Human) (Target 3)
    K2617404 1.0 ug DNA
    EUR 154
    Vps11 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K3882102 1.0 ug DNA
    EUR 154
    Vps11 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K3882103 1.0 ug DNA
    EUR 154
    Vps11 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K3882104 1.0 ug DNA
    EUR 154
    VPS11 Protein Vector (Mouse) (pPB-C-His)
    PV246498 500 ng
    EUR 1065
    VPS11 Protein Vector (Mouse) (pPB-N-His)
    PV246499 500 ng
    EUR 1065
    VPS11 Protein Vector (Mouse) (pPM-C-HA)
    PV246500 500 ng
    EUR 1065
    VPS11 Protein Vector (Mouse) (pPM-C-His)
    PV246501 500 ng
    EUR 1065
    VPS11 Protein Vector (Rat) (pPB-C-His)
    PV315982 500 ng
    EUR 1166
    VPS11 Protein Vector (Rat) (pPB-N-His)
    PV315983 500 ng
    EUR 1166
    VPS11 Protein Vector (Rat) (pPM-C-HA)
    PV315984 500 ng
    EUR 1166
    VPS11 Protein Vector (Rat) (pPM-C-His)
    PV315985 500 ng
    EUR 1166
    VPS11 Protein Vector (Human) (pPB-C-His)
    PV045813 500 ng
    EUR 329
    VPS11 Protein Vector (Human) (pPB-N-His)
    PV045814 500 ng
    EUR 329
    VPS11 Protein Vector (Human) (pPM-C-HA)
    PV045815 500 ng
    EUR 329
    VPS11 Protein Vector (Human) (pPM-C-His)
    PV045816 500 ng
    EUR 329
    Vps11 3'UTR Luciferase Stable Cell Line
    TU122115 1.0 ml Ask for price
    VPS11 3'UTR GFP Stable Cell Line
    TU078279 1.0 ml
    EUR 2333
    Vps11 3'UTR GFP Stable Cell Line
    TU172115 1.0 ml Ask for price
    Vps11 3'UTR Luciferase Stable Cell Line
    TU223240 1.0 ml Ask for price
    VPS11 3'UTR Luciferase Stable Cell Line
    TU028279 1.0 ml
    EUR 2333
    Vps11 3'UTR GFP Stable Cell Line
    TU273240 1.0 ml Ask for price
    GAPDH Rabbit Polyclonal Antibody
    37985-100ul 100ul
    EUR 252
    GAPDH Rabbit Polyclonal Antibody
    37985-50ul 50ul
    EUR 187
    EFHD1 Rabbit Polyclonal Antibody
    38001-100ul 100ul
    EUR 252
    EFHD1 Rabbit Polyclonal Antibody
    38001-50ul 50ul
    EUR 187
    Alliinase Rabbit Polyclonal Antibody
    38042-100ul 100ul
    EUR 252
    Alliinase Rabbit Polyclonal Antibody
    38042-50ul 50ul
    EUR 187
    ECFP Rabbit Polyclonal Antibody
    38077-100ul 100ul
    EUR 252
    ECFP Rabbit Polyclonal Antibody
    38077-50ul 50ul
    EUR 187
    EYFP Rabbit Polyclonal Antibody
    38078-100ul 100ul
    EUR 252
    EYFP Rabbit Polyclonal Antibody
    38078-50ul 50ul
    EUR 187
    mOrange Rabbit Polyclonal Antibody
    38079-100ul 100ul
    EUR 252
    mOrange Rabbit Polyclonal Antibody
    38079-50ul 50ul
    EUR 187
    mStrawberry Rabbit Polyclonal Antibody
    38083-100ul 100ul
    EUR 252
    mStrawberry Rabbit Polyclonal Antibody
    38083-50ul 50ul
    EUR 187
    AmCyan Rabbit Polyclonal Antibody
    38086-100ul 100ul
    EUR 252
    AmCyan Rabbit Polyclonal Antibody
    38086-50ul 50ul
    EUR 187
    EBFP Rabbit Polyclonal Antibody
    38087-100ul 100ul
    EUR 252
    EBFP Rabbit Polyclonal Antibody
    38087-50ul 50ul
    EUR 187
    Vimentin Rabbit Polyclonal Antibody
    38104-100ul 100ul
    EUR 252
    Vimentin Rabbit Polyclonal Antibody
    38104-50ul 50ul
    EUR 187
    LDHD Rabbit Polyclonal Antibody
    38105-100ul 100ul
    EUR 252
    LDHD Rabbit Polyclonal Antibody
    38105-50ul 50ul
    EUR 187
    GAPDH Rabbit Polyclonal Antibody
    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    Rabbit Hemoglobin Polyclonal Antibody
    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products
    Met Rabbit Polyclonal Antibody
    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    VEGF Rabbit Polyclonal Antibody
    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    CD10 Rabbit Polyclonal Antibody
    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    NM23A Rabbit Polyclonal Antibody
    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    ATM Rabbit Polyclonal Antibody
    ABP57463-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57463-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57463-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    JAK1 Rabbit Polyclonal Antibody
    ABP57569-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
    JAK1 Rabbit Polyclonal Antibody
    ABP57569-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
    JAK1 Rabbit Polyclonal Antibody
    ABP57569-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
    JAK2 Rabbit Polyclonal Antibody
    ABP57570-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
    JAK2 Rabbit Polyclonal Antibody
    ABP57570-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
    JAK2 Rabbit Polyclonal Antibody
    ABP57570-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
    JNK2 Rabbit Polyclonal Antibody
    ABP57571-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
    JNK2 Rabbit Polyclonal Antibody
    ABP57571-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
    JNK2 Rabbit Polyclonal Antibody
    ABP57571-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
    JNK3 Rabbit Polyclonal Antibody
    ABP57572-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
    JNK3 Rabbit Polyclonal Antibody
    ABP57572-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
    JNK3 Rabbit Polyclonal Antibody
    ABP57572-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
    MEK2 Rabbit Polyclonal Antibody
    ABP57573-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
    MEK2 Rabbit Polyclonal Antibody
    ABP57573-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
    MEK2 Rabbit Polyclonal Antibody
    ABP57573-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
    MEK3 Rabbit Polyclonal Antibody
    ABP57574-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
    MEK3 Rabbit Polyclonal Antibody
    ABP57574-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
    MEK3 Rabbit Polyclonal Antibody
    ABP57574-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
    Nrf2 Rabbit Polyclonal Antibody
    ABP57575-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
    Nrf2 Rabbit Polyclonal Antibody
    ABP57575-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
    Nrf2 Rabbit Polyclonal Antibody
    ABP57575-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
    ATG4a Rabbit Polyclonal Antibody
    ABP57576-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
    ATG4a Rabbit Polyclonal Antibody
    ABP57576-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
    ATG4a Rabbit Polyclonal Antibody
    ABP57576-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
    ATG4b Rabbit Polyclonal Antibody
    ABP57577-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
    ATG4b Rabbit Polyclonal Antibody
    ABP57577-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
    ATG4b Rabbit Polyclonal Antibody
    ABP57577-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
    ATG4c Rabbit Polyclonal Antibody
    ABP57578-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
    ATG4c Rabbit Polyclonal Antibody
    ABP57578-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
    ATG4c Rabbit Polyclonal Antibody
    ABP57578-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
    ATG5 Rabbit Polyclonal Antibody
    ABP57579-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5
    ATG5 Rabbit Polyclonal Antibody
    ABP57579-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5
    ATG5 Rabbit Polyclonal Antibody
    ABP57579-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5
    ATG7 Rabbit Polyclonal Antibody
    ABP57580-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7
    ATG7 Rabbit Polyclonal Antibody
    ABP57580-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7
    ATG7 Rabbit Polyclonal Antibody
    ABP57580-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7
    ATG13 Rabbit Polyclonal Antibody
    ABP57581-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
    ATG13 Rabbit Polyclonal Antibody
    ABP57581-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
    ATG13 Rabbit Polyclonal Antibody
    ABP57581-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
    ATG13 Rabbit Polyclonal Antibody
    ABP57582-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
    ATG13 Rabbit Polyclonal Antibody
    ABP57582-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
    ATG13 Rabbit Polyclonal Antibody
    ABP57582-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
    ATG14L Rabbit Polyclonal Antibody
    ABP57583-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L
    ATG14L Rabbit Polyclonal Antibody
    ABP57583-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L
    ATG14L Rabbit Polyclonal Antibody
    ABP57583-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L
    NBR1 Rabbit Polyclonal Antibody
    ABP57585-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1
    NBR1 Rabbit Polyclonal Antibody
    ABP57585-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1
    NBR1 Rabbit Polyclonal Antibody
    ABP57585-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1
    NBR1 Rabbit Polyclonal Antibody
    ABP57586-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1
    NBR1 Rabbit Polyclonal Antibody
    ABP57586-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1
    NBR1 Rabbit Polyclonal Antibody
    ABP57586-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1
    WIPI2 Rabbit Polyclonal Antibody
    ABP57587-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of WIPI2
    • Applications tips:
    Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2
    WIPI2 Rabbit Polyclonal Antibody
    ABP57587-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of WIPI2
    • Applications tips:
    Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2
    WIPI2 Rabbit Polyclonal Antibody
    ABP57587-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of WIPI2
    • Applications tips:
    Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2
    FAK Rabbit Polyclonal Antibody
    ABP57588-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of FAK
    • Applications tips:
    Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK
    FAK Rabbit Polyclonal Antibody
    ABP57588-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of FAK
    • Applications tips:
    Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK
    FAK Rabbit Polyclonal Antibody
    ABP57588-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of FAK
    • Applications tips:
    Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK
    Gab1 Rabbit Polyclonal Antibody
    ABP57589-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Gab1
    • Applications tips:
    Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1
    Gab1 Rabbit Polyclonal Antibody
    ABP57589-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Gab1
    • Applications tips:
    Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1
    Gab1 Rabbit Polyclonal Antibody
    ABP57589-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Gab1
    • Applications tips:
    Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1
    ERK1 Rabbit Polyclonal Antibody
    ABP57590-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ERK1
    • Applications tips:
    Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1
    ERK1 Rabbit Polyclonal Antibody
    ABP57590-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ERK1
    • Applications tips:
    Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1
    ERK1 Rabbit Polyclonal Antibody
    ABP57590-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ERK1
    • Applications tips:
    Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1
    VEGF Rabbit Polyclonal Antibody
    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    VEGF Rabbit Polyclonal Antibody
    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    CD10 Rabbit Polyclonal Antibody
    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    CD10 Rabbit Polyclonal Antibody
    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NM23A Rabbit Polyclonal Antibody
    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NM23A Rabbit Polyclonal Antibody
    ES8455-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8456-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8456-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8457-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    VPS11 Rabbit Polyclonal Antibody