GPR61 Rabbit Polyclonal Antibody

GPR61 Rabbit Polyclonal Antibody

Contact Us Below To Order :

GPR61 Polyclonal Antibody

ES11477-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR61 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPR61 Polyclonal Antibody

ES11477-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR61 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPR61 antibody

20R-GR035 50 ug
EUR 656
Description: Rabbit polyclonal GPR61 antibody

GPR61 antibody

20R-GR069 50 ug
EUR 656
Description: Rabbit polyclonal GPR61 antibody

GPR61 antibody

20R-GR070 50 ug
EUR 656
Description: Rabbit polyclonal GPR61 antibody

GPR61 Antibody

44933-100ul 100ul
EUR 252

GPR61 Antibody

44933-50ul 50ul
EUR 187

GPR61 Antibody

DF2755 200ul
EUR 304
Description: GPR61 antibody detects endogenous levels of total GPR61.

GPR61 Antibody

DF2810 200ul
EUR 304
Description: GPR61 antibody detects endogenous levels of total GPR61.

GPR61 Antibody

ABD2755 100 ug
EUR 438

GPR61 Antibody

ABD2810 100 ug
EUR 438

Polyclonal GPR61 Antibody (C-Terminus)

APR16588G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR61 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GPR61 Antibody (C-Terminus)

APR16589G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR61 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GPR61 Antibody (Cytoplasmic Domain)

APR16590G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR61 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR61 Antibody (Extracellular Domain)

APR16591G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR61 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR61 Antibody (N-Terminus)

APR16592G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR61 (N-Terminus). This antibody is tested and proven to work in the following applications:

GPR61 Conjugated Antibody

C44933 100ul
EUR 397

Anti-GPR61 antibody

STJ192635 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPR61

GPR61 siRNA

20-abx918539
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR61 siRNA

20-abx918540
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GPR61

YF-PA21277 50 ug
EUR 363
Description: Mouse polyclonal to GPR61

GPR61 Blocking Peptide

DF2755-BP 1mg
EUR 195

GPR61 Blocking Peptide

DF2810-BP 1mg
EUR 195

GPR61 cloning plasmid

CSB-CL866330HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1356
  • Sequence: atggagtcctcacccatcccccagtcatcagggaactcttccactttggggagggtccctcaaaccccaggtccctctactgccagtggggtcccggaggtggggctacgggatgttgcttcggaatctgtggccctcttcttcatgctcctgctggacttgactgctgtggctg
  • Show more
Description: A cloning plasmid for the GPR61 gene.

Mouse GPR61 shRNA Plasmid

20-abx981729
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPR61 shRNA Plasmid

20-abx963213
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPR61 Recombinant Protein (Human)

RP013882 100 ug Ask for price

GPR61 Recombinant Protein (Rat)

RP203447 100 ug Ask for price

GPR61 Recombinant Protein (Mouse)

RP139673 100 ug Ask for price

Gpr61 ORF Vector (Rat) (pORF)

ORF067817 1.0 ug DNA
EUR 506

GPR61 ORF Vector (Human) (pORF)

ORF004628 1.0 ug DNA
EUR 95

Gpr61 ORF Vector (Mouse) (pORF)

ORF046559 1.0 ug DNA
EUR 506

Probable G-Protein Coupled Receptor 61 (GPR61) Antibody

20-abx147479
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Probable G-Protein Coupled Receptor 61 (GPR61) Antibody

abx147480-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Gpr61 sgRNA CRISPR Lentivector set (Rat)

K6526201 3 x 1.0 ug
EUR 339

Gpr61 sgRNA CRISPR Lentivector set (Mouse)

K3882801 3 x 1.0 ug
EUR 339

GPR61 sgRNA CRISPR Lentivector set (Human)

K0892201 3 x 1.0 ug
EUR 339

Gpr61 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6526202 1.0 ug DNA
EUR 154

Gpr61 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6526203 1.0 ug DNA
EUR 154

Gpr61 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6526204 1.0 ug DNA
EUR 154

Gpr61 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3882802 1.0 ug DNA
EUR 154

Gpr61 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3882803 1.0 ug DNA
EUR 154

Gpr61 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3882804 1.0 ug DNA
EUR 154

GPR61 sgRNA CRISPR Lentivector (Human) (Target 1)

K0892202 1.0 ug DNA
EUR 154

GPR61 sgRNA CRISPR Lentivector (Human) (Target 2)

K0892203 1.0 ug DNA
EUR 154

GPR61 sgRNA CRISPR Lentivector (Human) (Target 3)

K0892204 1.0 ug DNA
EUR 154

GPR61 Rabbit Polyclonal Antibody