RBMS1 Rabbit Polyclonal Antibody

RBMS1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    RBMS1 Rabbit pAb

    A3079-100ul 100 ul
    EUR 308

    RBMS1 Rabbit pAb

    A3079-200ul 200 ul
    EUR 459

    RBMS1 Rabbit pAb

    A3079-20ul 20 ul
    EUR 183

    RBMS1 Rabbit pAb

    A3079-50ul 50 ul
    EUR 223

    RBMS1 Antibody

    37024-100ul 100ul
    EUR 252

    RBMS1 antibody

    70R-19819 50 ul
    EUR 435
    Description: Rabbit polyclonal RBMS1 antibody

    RBMS1 antibody

    70R-1624 100 ug
    EUR 377
    Description: Rabbit polyclonal RBMS1 antibody raised against the C terminal of RBMS1

    RBMS1 antibody

    70R-1625 100 ug
    EUR 377
    Description: Rabbit polyclonal RBMS1 antibody raised against the middle region of RBMS1

    RBMS1 Antibody

    1-CSB-PA265034
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against RBMS1. Recognizes RBMS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

    RBMS1 Antibody

    1-CSB-PA145037
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against RBMS1. Recognizes RBMS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

    RBMS1 Antibody

    1-CSB-PA019440GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against RBMS1. Recognizes RBMS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IF

    RBMS1 Antibody

    1-CSB-PA019440LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBMS1. Recognizes RBMS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

    RBMS1 Conjugated Antibody

    C37024 100ul
    EUR 397

    anti- RBMS1 antibody

    FNab07185 100µg
    EUR 548.75
    • Immunogen: RNA binding motif, single stranded interacting protein 1
    • Uniprot ID: P29558
    • Gene ID: 5937
    • Research Area: Metabolism
    Description: Antibody raised against RBMS1

    Anti-RBMS1 antibody

    PAab07185 100 ug
    EUR 386

    Anti-RBMS1 antibody

    STJ27687 100 µl
    EUR 277
    Description: This gene encodes a member of a small family of proteins which bind single stranded DNA/RNA. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. Several transcript variants, resulting from alternative splicing and encoding different isoforms, have been described. A pseudogene for this locus is found on chromosome 12.

    Anti-RBMS1 antibody

    STJ193093 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to RBMS1

    Rbms1/ Rat Rbms1 ELISA Kit

    ELI-52317r 96 Tests
    EUR 886

    RBMS1 siRNA

    20-abx904507
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RBMS1 siRNA

    20-abx931096
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RBMS1 siRNA

    20-abx931097
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    anti-RBMS1

    YF-PA14320 50 ul
    EUR 363
    Description: Mouse polyclonal to RBMS1

    anti-RBMS1

    YF-PA14321 50 ug
    EUR 363
    Description: Mouse polyclonal to RBMS1

    anti-RBMS1

    YF-PA14322 100 ul
    EUR 403
    Description: Rabbit polyclonal to RBMS1

    anti-RBMS1

    YF-PA14323 100 ug
    EUR 403
    Description: Rabbit polyclonal to RBMS1

    anti-RBMS1

    YF-PA14324 50 ul
    EUR 363
    Description: Mouse polyclonal to RBMS1

    anti-RBMS1

    YF-PA14325 100 ug
    EUR 403
    Description: Rabbit polyclonal to RBMS1

    anti-RBMS1

    YF-PA14326 100 ug
    EUR 403
    Description: Rabbit polyclonal to RBMS1

    anti-RBMS1

    YF-PA24559 50 ul
    EUR 334
    Description: Mouse polyclonal to RBMS1

    RBMS1 Antibody, HRP conjugated

    1-CSB-PA019440LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBMS1. Recognizes RBMS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    RBMS1 Antibody, FITC conjugated

    1-CSB-PA019440LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBMS1. Recognizes RBMS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    RBMS1 Antibody, Biotin conjugated

    1-CSB-PA019440LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBMS1. Recognizes RBMS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    RBMS1 cloning plasmid

    CSB-CL019440HU1-10ug 10ug
    EUR 451
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1221
    • Sequence: atgggcaaagtgtggaaacagcagatgtaccctcagtacgccacctactattacccccagtatctgcaagccaagcagtctctggtcccagcccaccccatggcccctcccagtcccagcaccaccagcagtaataacaacagtagcagcagtagcaactcaggatgggatcagc
    • Show more
    Description: A cloning plasmid for the RBMS1 gene.

    RBMS1 cloning plasmid

    CSB-CL019440HU2-10ug 10ug
    EUR 448
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1212
    • Sequence: atgggcaaagtgtggaaacagcagatgtaccctcagtacgccacctactattacccccagtatctgcaagccaagcagtctctggtcccagcccaccccatggcccctcccagtcccagcaccaccagcagtaataacaacagtagcagcagtagcaactcaggatgggatcagc
    • Show more
    Description: A cloning plasmid for the RBMS1 gene.

    RBMS1 Blocking Peptide

    33R-3655 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS1 antibody, catalog no. 70R-1625

    RBMS1 Blocking Peptide

    33R-9396 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS1 antibody, catalog no. 70R-1624

    pCMV-SPORT6-RBMS1

    PVT14167 2 ug
    EUR 495

    Anti-RBMS1 (M1)

    YF-MA15128 100 ug
    EUR 363
    Description: Mouse monoclonal to RBMS1

    Anti-RBMS1 (3B12)

    YF-MA15129 100 ug
    EUR 363
    Description: Mouse monoclonal to RBMS1

    Anti-RBMS1 (3B2)

    YF-MA15130 100 ug
    EUR 363
    Description: Mouse monoclonal to RBMS1

    Anti-RBMS1 (4E2)

    YF-MA15131 100 ug
    EUR 363
    Description: Mouse monoclonal to RBMS1

    Mouse RBMS1 shRNA Plasmid

    20-abx974934
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat RBMS1 shRNA Plasmid

    20-abx990329
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Bovine RBMS1 ELISA KIT

    ELI-14150b 96 Tests
    EUR 928

    Human RBMS1 ELISA KIT

    ELI-19259h 96 Tests
    EUR 824

    Mouse Rbms1 ELISA KIT

    ELI-22543m 96 Tests
    EUR 865

    RBMS1 ELISA KIT|Human

    EF002371 96 Tests
    EUR 689

    Human RBMS1 shRNA Plasmid

    20-abx954023
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    RBMS1 Recombinant Protein (Human)

    RP025999 100 ug Ask for price

    RBMS1 Recombinant Protein (Human)

    RP026002 100 ug Ask for price

    RBMS1 Recombinant Protein (Human)

    RP042790 100 ug Ask for price

    RBMS1 Recombinant Protein (Rat)

    RP223877 100 ug Ask for price

    RBMS1 Recombinant Protein (Mouse)

    RP167246 100 ug Ask for price

    RBMS1 Recombinant Protein (Mouse)

    RP167249 100 ug Ask for price

    RBMS1 Recombinant Protein (Mouse)

    RP167252 100 ug Ask for price

    Anti-RBMS1 (3F2-2G9)

    YF-MA15127 100 ug
    EUR 363
    Description: Mouse monoclonal to RBMS1

    RBMS1 ORF Vector (Human) (pORF)

    ORF008667 1.0 ug DNA
    EUR 95

    RBMS1 ORF Vector (Human) (pORF)

    ORF008668 1.0 ug DNA
    EUR 95

    Rbms1 ORF Vector (Rat) (pORF)

    ORF074627 1.0 ug DNA
    EUR 506

    RBMS1 ORF Vector (Human) (pORF)

    ORF014264 1.0 ug DNA
    EUR 354

    Rbms1 ORF Vector (Mouse) (pORF)

    ORF055750 1.0 ug DNA
    EUR 506

    Rbms1 ORF Vector (Mouse) (pORF)

    ORF055751 1.0 ug DNA
    EUR 506

    Rbms1 ORF Vector (Mouse) (pORF)

    ORF055752 1.0 ug DNA
    EUR 506

    RBMS1 sgRNA CRISPR Lentivector set (Human)

    K1796301 3 x 1.0 ug
    EUR 339

    Rbms1 sgRNA CRISPR Lentivector set (Mouse)

    K4750901 3 x 1.0 ug
    EUR 339

    Rbms1 sgRNA CRISPR Lentivector set (Rat)

    K6622901 3 x 1.0 ug
    EUR 339

    RBMS1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1796302 1.0 ug DNA
    EUR 154

    RBMS1 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1796303 1.0 ug DNA
    EUR 154

    RBMS1 sgRNA CRISPR Lentivector (Human) (Target 3)

    K1796304 1.0 ug DNA
    EUR 154

    Rbms1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4750902 1.0 ug DNA
    EUR 154

    Rbms1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4750903 1.0 ug DNA
    EUR 154

    Rbms1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4750904 1.0 ug DNA
    EUR 154

    Rbms1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6622902 1.0 ug DNA
    EUR 154

    Rbms1 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6622903 1.0 ug DNA
    EUR 154

    Rbms1 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6622904 1.0 ug DNA
    EUR 154

    RBMS1 Protein Vector (Human) (pPB-C-His)

    PV057053 500 ng
    EUR 481

    RBMS1 Protein Vector (Human) (pPB-N-His)

    PV057054 500 ng
    EUR 481

    RBMS1 Protein Vector (Human) (pPM-C-HA)

    PV057055 500 ng
    EUR 481

    RBMS1 Protein Vector (Human) (pPM-C-His)

    PV057056 500 ng
    EUR 481

    RBMS1 Protein Vector (Human) (pPB-C-His)

    PV034665 500 ng
    EUR 329

    RBMS1 Protein Vector (Human) (pPB-N-His)

    PV034666 500 ng
    EUR 329

    RBMS1 Protein Vector (Human) (pPM-C-HA)

    PV034667 500 ng
    EUR 329

    RBMS1 Protein Vector (Human) (pPM-C-His)

    PV034668 500 ng
    EUR 329

    RBMS1 Protein Vector (Human) (pPB-C-His)

    PV034669 500 ng
    EUR 329

    RBMS1 Protein Vector (Human) (pPB-N-His)

    PV034670 500 ng
    EUR 329

    RBMS1 Protein Vector (Human) (pPM-C-HA)

    PV034671 500 ng
    EUR 329

    RBMS1 Protein Vector (Human) (pPM-C-His)

    PV034672 500 ng
    EUR 329

    RBMS1 Protein Vector (Rat) (pPB-C-His)

    PV298506 500 ng
    EUR 603

    RBMS1 Protein Vector (Rat) (pPB-N-His)

    PV298507 500 ng
    EUR 603

    RBMS1 Protein Vector (Rat) (pPM-C-HA)

    PV298508 500 ng
    EUR 603

    RBMS1 Protein Vector (Rat) (pPM-C-His)

    PV298509 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPB-C-His)

    PV222998 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPB-N-His)

    PV222999 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPM-C-HA)

    PV223000 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPM-C-His)

    PV223001 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPB-C-His)

    PV223002 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPB-N-His)

    PV223003 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPM-C-HA)

    PV223004 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPM-C-His)

    PV223005 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPB-C-His)

    PV223006 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPB-N-His)

    PV223007 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPM-C-HA)

    PV223008 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPM-C-His)

    PV223009 500 ng
    EUR 603

    Rbms1 3'UTR GFP Stable Cell Line

    TU167639 1.0 ml Ask for price

    RBMS1 3'UTR Luciferase Stable Cell Line

    TU019619 1.0 ml
    EUR 4617

    Rbms1 3'UTR Luciferase Stable Cell Line

    TU117639 1.0 ml Ask for price

    RBMS1 3'UTR GFP Stable Cell Line

    TU069619 1.0 ml
    EUR 4617

    Rbms1 3'UTR GFP Stable Cell Line

    TU267402 1.0 ml Ask for price

    Rbms1 3'UTR Luciferase Stable Cell Line

    TU217402 1.0 ml Ask for price

    Suppressor of CDC2 With RNA-Binding Motif 2 (RBMS1) Antibody

    20-abx115327
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Suppressor of CDC2 With RNA-Binding Motif 2 (RBMS1) Antibody

    20-abx007302
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Suppressor Of CDC2 With RNA-Binding Motif 2 (RBMS1) Antibody

    20-abx214386
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Suppressor Of CDC2 With RNA-Binding Motif 2 (RBMS1) Antibody

    20-abx214508
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Suppressor Of CDC2 With RNA-Binding Motif 2 (RBMS1) Antibody

    20-abx338604
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Suppressor of CDC2 With RNA-Binding Motif 2 (RBMS1) Antibody

    abx237185-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    VEGF Rabbit Polyclonal Antibody

    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    VEGF Rabbit Polyclonal Antibody

    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    IkB ? Rabbit Polyclonal Antibody

    ES8561-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    IkB ? Rabbit Polyclonal Antibody

    ES8561-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JAK1 Rabbit Polyclonal Antibody

    ES8562-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK1 Rabbit Polyclonal Antibody

    ES8562-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK2 Rabbit Polyclonal Antibody

    ES8563-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK2 Rabbit Polyclonal Antibody

    ES8563-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JNK2 Rabbit Polyclonal Antibody

    ES8564-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JNK2 Rabbit Polyclonal Antibody

    ES8564-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JNK3 Rabbit Polyclonal Antibody

    ES8565-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JNK3 Rabbit Polyclonal Antibody

    ES8565-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    MEK2 Rabbit Polyclonal Antibody

    ES8566-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

    MEK2 Rabbit Polyclonal Antibody

    ES8566-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

    MEK3 Rabbit Polyclonal Antibody

    ES8567-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    MEK3 Rabbit Polyclonal Antibody

    ES8567-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Nrf2 Rabbit Polyclonal Antibody

    ES8568-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Nrf2 Rabbit Polyclonal Antibody

    ES8568-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4a Rabbit Polyclonal Antibody

    ES8569-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4a Rabbit Polyclonal Antibody

    ES8569-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4b Rabbit Polyclonal Antibody

    ES8570-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4b Rabbit Polyclonal Antibody

    ES8570-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4c Rabbit Polyclonal Antibody

    ES8571-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4c Rabbit Polyclonal Antibody

    ES8571-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG5 Rabbit Polyclonal Antibody

    ES8572-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG5 Rabbit Polyclonal Antibody

    ES8572-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG7 Rabbit Polyclonal Antibody

    ES8573-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG7 Rabbit Polyclonal Antibody

    ES8573-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8574-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8574-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8575-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8575-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG14L Rabbit Polyclonal Antibody

    ES8576-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG14L Rabbit Polyclonal Antibody

    ES8576-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8578-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8578-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8579-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    RBMS1 Rabbit Polyclonal Antibody