GPR6 Rabbit Polyclonal Antibody

GPR6 Rabbit Polyclonal Antibody

Contact Us Below To Order :

GPR6 Polyclonal Antibody

ABP58694-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GPR6 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of GPR6 from Human, Mouse, Rat. This GPR6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR6 protein at amino acid sequence of 290-370

GPR6 Polyclonal Antibody

ES11476-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPR6 Polyclonal Antibody

ES11476-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPR6 Rabbit pAb

A14738-100ul 100 ul
EUR 308

GPR6 Rabbit pAb

A14738-200ul 200 ul
EUR 459

GPR6 Rabbit pAb

A14738-20ul 20 ul
EUR 183

GPR6 Rabbit pAb

A14738-50ul 50 ul
EUR 223

GPR6 Rabbit pAb

A2961-100ul 100 ul
EUR 308

GPR6 Rabbit pAb

A2961-200ul 200 ul
EUR 459

GPR6 Rabbit pAb

A2961-20ul 20 ul Ask for price

GPR6 Rabbit pAb

A2961-50ul 50 ul
EUR 223

GPR6 Antibody

31210-100ul 100ul
EUR 252

GPR6 Antibody

31210-50ul 50ul
EUR 187

GPR6 Antibody

DF2754 200ul
EUR 304
Description: GPR6 antibody detects endogenous levels of total GPR6.

GPR6 Antibody

1-CSB-PA363377
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GPR6. Recognizes GPR6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:10-1:50

GPR6 Antibody

1-CSB-PA197658
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GPR6. Recognizes GPR6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

GPR6 antibody

70R-6934 50 ug
EUR 467
Description: Rabbit polyclonal GPR6 antibody raised against the N terminal of GPR6

GPR6 Antibody

ABD2754 100 ug
EUR 438

Polyclonal GPR6 Antibody (Cytoplasmic Domain)

APR12230G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR6 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR6 antibody - N-terminal region

APR12231G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR6 - N-terminal region. This antibody is tested and proven to work in the following applications:

Gpr6/ Rat Gpr6 ELISA Kit

ELI-27480r 96 Tests
EUR 886

GPR6 Conjugated Antibody

C31210 100ul
EUR 397

Anti-GPR6 antibody

STJ116938 100 µl
EUR 277

Anti-GPR6 antibody

STJ192634 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPR6

Anti-GPR6 antibody

STJ23844 100 µl
EUR 277

GPR6 siRNA

20-abx902289
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR6 siRNA

20-abx918551
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR6 siRNA

20-abx918552
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR6 Blocking Peptide

33R-6644 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GPR6 antibody, catalog no. 70R-6934

GPR6 Blocking Peptide

DF2754-BP 1mg
EUR 195

GPR6 cloning plasmid

CSB-CL009822HU1-10ug 10ug
EUR 415
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1089
  • Sequence: atgaacgcgagcgccgcctcgctcaacgactcccaggtggtggtagtggcggccgaaggagcggcggcggcggccacagcagcaggggggccggacacgggcgaatggggaccccctgctgcggcggctctaggagccggcggcggagctaatgggtctctggagctgtcctcgc
  • Show more
Description: A cloning plasmid for the GPR6 gene.

GPR6 cloning plasmid

CSB-CL009822HU2-10ug 10ug
EUR 415
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1089
  • Sequence: atgaacgcgagcgccgcctcgctcaacgactcccaggtggtggtagtggcggccgaaggagcggcggcggcggccacagcagcaggggggccggacacgggcgaatggggaccccctgctgcggcggctctaggagccggcggcggagctaatgggtctctggagctgtcctcgc
  • Show more
Description: A cloning plasmid for the GPR6 gene.

Rat GPR6 shRNA Plasmid

20-abx986830
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPR6 shRNA Plasmid

20-abx951895
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GPR6 shRNA Plasmid

20-abx980268
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPR6 Recombinant Protein (Human)

RP039586 100 ug Ask for price

GPR6 Recombinant Protein (Human)

RP039589 100 ug Ask for price

GPR6 Recombinant Protein (Rat)

RP203444 100 ug Ask for price

GPR6 Recombinant Protein (Mouse)

RP139670 100 ug Ask for price

G Protein-Coupled Receptor 6 (GPR6) Antibody

20-abx007385
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 6 (GPR6) Antibody

20-abx214714
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 6 (GPR6) Antibody

20-abx214733
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gpr6 ORF Vector (Rat) (pORF)

ORF067816 1.0 ug DNA
EUR 506

GPR6 ORF Vector (Human) (pORF)

ORF013196 1.0 ug DNA
EUR 354

GPR6 Rabbit Polyclonal Antibody