GPR6 Rabbit Polyclonal Antibody

GPR6 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    GPR6 Polyclonal Antibody

    ABP58694-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human GPR6 protein at amino acid sequence of 290-370
    • Applications tips:
    Description: A polyclonal antibody for detection of GPR6 from Human, Mouse, Rat. This GPR6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR6 protein at amino acid sequence of 290-370

    GPR6 Polyclonal Antibody

    ES11476-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against GPR6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    GPR6 Polyclonal Antibody

    ES11476-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against GPR6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    GPR6 Rabbit pAb

    A14738-100ul 100 ul
    EUR 308

    GPR6 Rabbit pAb

    A14738-200ul 200 ul
    EUR 459

    GPR6 Rabbit pAb

    A14738-20ul 20 ul
    EUR 183

    GPR6 Rabbit pAb

    A14738-50ul 50 ul
    EUR 223

    GPR6 Rabbit pAb

    A2961-100ul 100 ul
    EUR 308

    GPR6 Rabbit pAb

    A2961-200ul 200 ul
    EUR 459

    GPR6 Rabbit pAb

    A2961-20ul 20 ul Ask for price

    GPR6 Rabbit pAb

    A2961-50ul 50 ul
    EUR 223

    GPR6 Antibody

    31210-100ul 100ul
    EUR 252

    GPR6 Antibody

    31210-50ul 50ul
    EUR 187

    GPR6 Antibody

    DF2754 200ul
    EUR 304
    Description: GPR6 antibody detects endogenous levels of total GPR6.

    GPR6 Antibody

    1-CSB-PA363377
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against GPR6. Recognizes GPR6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:10-1:50

    GPR6 Antibody

    1-CSB-PA197658
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against GPR6. Recognizes GPR6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

    GPR6 antibody

    70R-6934 50 ug
    EUR 467
    Description: Rabbit polyclonal GPR6 antibody raised against the N terminal of GPR6

    GPR6 Antibody

    ABD2754 100 ug
    EUR 438

    Polyclonal GPR6 Antibody (Cytoplasmic Domain)

    APR12230G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR6 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

    Polyclonal GPR6 antibody - N-terminal region

    APR12231G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR6 - N-terminal region. This antibody is tested and proven to work in the following applications:

    Gpr6/ Rat Gpr6 ELISA Kit

    ELI-27480r 96 Tests
    EUR 886

    GPR6 Conjugated Antibody

    C31210 100ul
    EUR 397

    Anti-GPR6 antibody

    STJ116938 100 µl
    EUR 277

    Anti-GPR6 antibody

    STJ192634 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to GPR6

    Anti-GPR6 antibody

    STJ23844 100 µl
    EUR 277

    GPR6 siRNA

    20-abx902289
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    GPR6 siRNA

    20-abx918551
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    GPR6 siRNA

    20-abx918552
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    GPR6 Blocking Peptide

    33R-6644 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GPR6 antibody, catalog no. 70R-6934

    GPR6 Blocking Peptide

    DF2754-BP 1mg
    EUR 195

    GPR6 cloning plasmid

    CSB-CL009822HU1-10ug 10ug
    EUR 415
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1089
    • Sequence: atgaacgcgagcgccgcctcgctcaacgactcccaggtggtggtagtggcggccgaaggagcggcggcggcggccacagcagcaggggggccggacacgggcgaatggggaccccctgctgcggcggctctaggagccggcggcggagctaatgggtctctggagctgtcctcgc
    • Show more
    Description: A cloning plasmid for the GPR6 gene.

    GPR6 cloning plasmid

    CSB-CL009822HU2-10ug 10ug
    EUR 415
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1089
    • Sequence: atgaacgcgagcgccgcctcgctcaacgactcccaggtggtggtagtggcggccgaaggagcggcggcggcggccacagcagcaggggggccggacacgggcgaatggggaccccctgctgcggcggctctaggagccggcggcggagctaatgggtctctggagctgtcctcgc
    • Show more
    Description: A cloning plasmid for the GPR6 gene.

    Rat GPR6 shRNA Plasmid

    20-abx986830
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human GPR6 shRNA Plasmid

    20-abx951895
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse GPR6 shRNA Plasmid

    20-abx980268
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    GPR6 Recombinant Protein (Human)

    RP039586 100 ug Ask for price

    GPR6 Recombinant Protein (Human)

    RP039589 100 ug Ask for price

    GPR6 Recombinant Protein (Rat)

    RP203444 100 ug Ask for price

    GPR6 Recombinant Protein (Mouse)

    RP139670 100 ug Ask for price

    G Protein-Coupled Receptor 6 (GPR6) Antibody

    20-abx007385
    • EUR 411.00
    • EUR 592.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.

    G Protein-Coupled Receptor 6 (GPR6) Antibody

    20-abx214714
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    G Protein-Coupled Receptor 6 (GPR6) Antibody

    20-abx214733
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Gpr6 ORF Vector (Rat) (pORF)

    ORF067816 1.0 ug DNA
    EUR 506

    GPR6 ORF Vector (Human) (pORF)

    ORF013196 1.0 ug DNA
    EUR 354

    GPR6 Rabbit Polyclonal Antibody