RAMP3 Rabbit Polyclonal Antibody

RAMP3 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    RAMP3 Polyclonal Antibody
    ES11934-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against RAMP3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
    RAMP3 Rabbit pAb
    A6715-100ul 100 ul
    EUR 308
    RAMP3 Rabbit pAb
    A6715-200ul 200 ul
    EUR 459
    RAMP3 Rabbit pAb
    A6715-20ul 20 ul
    EUR 183
    RAMP3 Rabbit pAb
    A6715-50ul 50 ul
    EUR 223
    RAMP3 antibody
    70R-19759 50 ul
    EUR 435
    Description: Rabbit polyclonal RAMP3 antibody
    RAMP3 Antibody
    35886-100ul 100ul
    EUR 252
    RAMP3 antibody
    39126-100ul 100ul
    EUR 252
    RAMP3 Antibody
    1-CSB-PA869855
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against RAMP3. Recognizes RAMP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
    RAMP3 Antibody
    1-CSB-PA019306GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against RAMP3. Recognizes RAMP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
    Polyclonal RAMP3 Antibody (C-term)
    AMM07512G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAMP3 (C-term). This antibody is tested and proven to work in the following applications:
    Ramp3/ Rat Ramp3 ELISA Kit
    ELI-30433r 96 Tests
    EUR 886
    RAMP3 Conjugated Antibody
    C35886 100ul
    EUR 397
    anti- RAMP3 antibody
    FNab07099 100µg
    EUR 548.75
    • Immunogen: receptor(G protein-coupled) activity modifying protein 3
    • Uniprot ID: O60896
    • Gene ID: 10268
    • Research Area: Signal Transduction
    Description: Antibody raised against RAMP3
    Anti-RAMP3 antibody
    PAab07099 100 ug
    EUR 386
    Anti-RAMP3 antibody
    STJ28798 100 µl
    EUR 277
    Description: The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP3) protein, CRLR functions as an adrenomedullin receptor.
    Anti-RAMP3 antibody
    STJ193092 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to RAMP3
    RAMP3 siRNA
    20-abx904460
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RAMP3 siRNA
    20-abx930844
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RAMP3 siRNA
    20-abx930845
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    anti-RAMP3
    YF-PA16847 50 ug
    EUR 363
    Description: Mouse polyclonal to RAMP3
    RAMP3 cloning plasmid
    CSB-CL019306HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 447
    • Sequence: atggagactggagcgctgcggcgcccgcaacttctcccgttgctgctgctgctctgcggtgggtgtcccagagcaggcggctgcaacgagacaggcctgttggagaggctgcccctgtgtgggaaggctttcgcagacatgatgggcaaggtggacgtctggaagtggtgcaacct
    • Show more
    Description: A cloning plasmid for the RAMP3 gene.
    RAMP3 cloning plasmid
    CSB-CL019306HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 447
    • Sequence: atggagactggagcgctgcggcgcccgcaacttctcccgttgctgctgctgctctgcggtgggtgtcccagagcaggcggctgcaacgagacaggcatgttggagaggctgcccctgtgtgggaaggctttcgcagacatgatgggcaaggtggacgtctggaagtggtgcaacct
    • Show more
    Description: A cloning plasmid for the RAMP3 gene.
    Anti-RAMP3 (1C11)
    YF-MA17227 100 ug
    EUR 363
    Description: Mouse monoclonal to RAMP3
    Anti-RAMP3 (1B4)
    YF-MA17228 100 ug
    EUR 363
    Description: Mouse monoclonal to RAMP3
    RAMP3 protein (His tag)
    80R-2674 20 ug
    EUR 349
    Description: Purified recombinant RAMP3 protein (His tag)
    RAMP3 ELISA KIT|Human
    EF002303 96 Tests
    EUR 689
    Mouse RAMP3 shRNA Plasmid
    20-abx974620
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Rat RAMP3 shRNA Plasmid
    20-abx985885
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human RAMP3 shRNA Plasmid
    20-abx956951
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    RAMP3 Recombinant Protein (Human)
    RP025720 100 ug Ask for price
    RAMP3 Recombinant Protein (Human)
    RP025723 100 ug Ask for price
    RAMP3 Recombinant Protein (Mouse)
    RP166694 100 ug Ask for price
    RAMP3 Recombinant Protein (Rat)
    RP223559 100 ug Ask for price
    Receptor Activity Modifying Protein 3 (RAMP3) Antibody
    20-abx005152
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Receptor Activity Modifying Protein 3 (RAMP3) Antibody
    20-abx115083
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Receptor Activity Modifying Protein 3 (RAMP3) Antibody
    20-abx241602
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Monoclonal RAMP3 Antibody (monoclonal) (M01), Clone: 1C11
    AMM07513G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human RAMP3 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1C11. This antibody is applicable in WB, E
    Receptor Activity Modifying Protein 3 (RAMP3) Antibody
    abx237099-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    Ramp3 ORF Vector (Rat) (pORF)
    ORF074521 1.0 ug DNA
    EUR 506
    RAMP3 ORF Vector (Human) (pORF)
    ORF008574 1.0 ug DNA
    EUR 95
    RAMP3 ORF Vector (Human) (pORF)
    ORF008575 1.0 ug DNA
    EUR 95
    Ramp3 ORF Vector (Mouse) (pORF)
    ORF055566 1.0 ug DNA
    EUR 506
    Rabbit Anti-Human Receptor Activity Modifying Protein 3 (RAMP3) antiserum #1
    RAMP31-S 100 ul
    EUR 457
    Ramp3 sgRNA CRISPR Lentivector set (Rat)
    K6864301 3 x 1.0 ug
    EUR 339
    RAMP3 sgRNA CRISPR Lentivector set (Human)
    K1783301 3 x 1.0 ug
    EUR 339
    Ramp3 sgRNA CRISPR Lentivector set (Mouse)
    K3660801 3 x 1.0 ug
    EUR 339
    Ramp3 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6864302 1.0 ug DNA
    EUR 154
    Ramp3 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6864303 1.0 ug DNA
    EUR 154
    Ramp3 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6864304 1.0 ug DNA
    EUR 154
    RAMP3 sgRNA CRISPR Lentivector (Human) (Target 1)
    K1783302 1.0 ug DNA
    EUR 154
    RAMP3 sgRNA CRISPR Lentivector (Human) (Target 2)
    K1783303 1.0 ug DNA
    EUR 154
    RAMP3 sgRNA CRISPR Lentivector (Human) (Target 3)
    K1783304 1.0 ug DNA
    EUR 154
    Ramp3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K3660802 1.0 ug DNA
    EUR 154
    Ramp3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K3660803 1.0 ug DNA
    EUR 154
    Ramp3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K3660804 1.0 ug DNA
    EUR 154
    RAMP3 Protein Vector (Rat) (pPB-C-His)
    PV298082 500 ng
    EUR 603
    RAMP3 Protein Vector (Rat) (pPB-N-His)
    PV298083 500 ng
    EUR 603
    RAMP3 Protein Vector (Rat) (pPM-C-HA)
    PV298084 500 ng
    EUR 603
    RAMP3 Protein Vector (Rat) (pPM-C-His)
    PV298085 500 ng
    EUR 603
    RAMP3 Protein Vector (Human) (pPB-C-His)
    PV034293 500 ng
    EUR 329
    RAMP3 Protein Vector (Human) (pPB-N-His)
    PV034294 500 ng
    EUR 329
    RAMP3 Protein Vector (Human) (pPM-C-HA)
    PV034295 500 ng
    EUR 329
    RAMP3 Protein Vector (Human) (pPM-C-His)
    PV034296 500 ng
    EUR 329
    RAMP3 Protein Vector (Human) (pPB-C-His)
    PV034297 500 ng
    EUR 329
    RAMP3 Protein Vector (Human) (pPB-N-His)
    PV034298 500 ng
    EUR 329
    RAMP3 Protein Vector (Human) (pPM-C-HA)
    PV034299 500 ng
    EUR 329
    RAMP3 Protein Vector (Human) (pPM-C-His)
    PV034300 500 ng
    EUR 329
    RAMP3 Protein Vector (Mouse) (pPB-C-His)
    PV222262 500 ng
    EUR 603
    RAMP3 Protein Vector (Mouse) (pPB-N-His)
    PV222263 500 ng
    EUR 603
    RAMP3 Protein Vector (Mouse) (pPM-C-HA)
    PV222264 500 ng
    EUR 603
    RAMP3 Protein Vector (Mouse) (pPM-C-His)
    PV222265 500 ng
    EUR 603
    Recombinant Human RAMP3 Protein, His, E.coli-100ug
    QP13260-100ug 100ug
    EUR 1261
    Recombinant Human RAMP3 Protein, His, E.coli-10ug
    QP13260-10ug 10ug
    EUR 201
    Recombinant Human RAMP3 Protein, His, E.coli-2ug
    QP13260-2ug 2ug
    EUR 155
    Ramp3 3'UTR Luciferase Stable Cell Line
    TU117511 1.0 ml Ask for price
    Ramp3 3'UTR GFP Stable Cell Line
    TU167511 1.0 ml Ask for price
    Ramp3 3'UTR Luciferase Stable Cell Line
    TU217284 1.0 ml Ask for price
    Ramp3 3'UTR GFP Stable Cell Line
    TU267284 1.0 ml Ask for price
    RAMP3 3'UTR GFP Stable Cell Line
    TU069486 1.0 ml
    EUR 1394
    RAMP3 3'UTR Luciferase Stable Cell Line
    TU019486 1.0 ml
    EUR 1394
    Rabbit Anti-Human Receptor Activity Modifying Protein 3 (RAMP3) IgG #1, aff. pure
    RAMP31-A 100 ug
    EUR 482
    RAMP3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
    LV714147 1.0 ug DNA
    EUR 316
    RAMP3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
    LV714151 1.0 ug DNA
    EUR 316
    RAMP3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
    LV714152 1.0 ug DNA
    EUR 316
    RAMP3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
    LV693277 1.0 ug DNA
    EUR 514
    RAMP3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
    LV693281 1.0 ug DNA
    EUR 514
    RAMP3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
    LV693282 1.0 ug DNA
    EUR 514
    GAPDH Rabbit Polyclonal Antibody
    37985-100ul 100ul
    EUR 252
    GAPDH Rabbit Polyclonal Antibody
    37985-50ul 50ul
    EUR 187
    EFHD1 Rabbit Polyclonal Antibody
    38001-100ul 100ul
    EUR 252
    EFHD1 Rabbit Polyclonal Antibody
    38001-50ul 50ul
    EUR 187
    Alliinase Rabbit Polyclonal Antibody
    38042-100ul 100ul
    EUR 252
    Alliinase Rabbit Polyclonal Antibody
    38042-50ul 50ul
    EUR 187
    ECFP Rabbit Polyclonal Antibody
    38077-100ul 100ul
    EUR 252
    ECFP Rabbit Polyclonal Antibody
    38077-50ul 50ul
    EUR 187
    EYFP Rabbit Polyclonal Antibody
    38078-100ul 100ul
    EUR 252
    EYFP Rabbit Polyclonal Antibody
    38078-50ul 50ul
    EUR 187
    mOrange Rabbit Polyclonal Antibody
    38079-100ul 100ul
    EUR 252
    mOrange Rabbit Polyclonal Antibody
    38079-50ul 50ul
    EUR 187
    mStrawberry Rabbit Polyclonal Antibody
    38083-100ul 100ul
    EUR 252
    mStrawberry Rabbit Polyclonal Antibody
    38083-50ul 50ul
    EUR 187
    AmCyan Rabbit Polyclonal Antibody
    38086-100ul 100ul
    EUR 252
    AmCyan Rabbit Polyclonal Antibody
    38086-50ul 50ul
    EUR 187
    EBFP Rabbit Polyclonal Antibody
    38087-100ul 100ul
    EUR 252
    EBFP Rabbit Polyclonal Antibody
    38087-50ul 50ul
    EUR 187
    Vimentin Rabbit Polyclonal Antibody
    38104-100ul 100ul
    EUR 252
    Vimentin Rabbit Polyclonal Antibody
    38104-50ul 50ul
    EUR 187
    LDHD Rabbit Polyclonal Antibody
    38105-100ul 100ul
    EUR 252
    LDHD Rabbit Polyclonal Antibody
    38105-50ul 50ul
    EUR 187
    GAPDH Rabbit Polyclonal Antibody
    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    Rabbit Hemoglobin Polyclonal Antibody
    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products
    Met Rabbit Polyclonal Antibody
    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    VEGF Rabbit Polyclonal Antibody
    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    CD10 Rabbit Polyclonal Antibody
    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    NM23A Rabbit Polyclonal Antibody
    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    ATM Rabbit Polyclonal Antibody
    ABP57463-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57463-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57463-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    JAK1 Rabbit Polyclonal Antibody
    ABP57569-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
    JAK1 Rabbit Polyclonal Antibody
    ABP57569-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
    JAK1 Rabbit Polyclonal Antibody
    ABP57569-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
    JAK2 Rabbit Polyclonal Antibody
    ABP57570-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
    JAK2 Rabbit Polyclonal Antibody
    ABP57570-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
    JAK2 Rabbit Polyclonal Antibody
    ABP57570-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
    JNK2 Rabbit Polyclonal Antibody
    ABP57571-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
    JNK2 Rabbit Polyclonal Antibody
    ABP57571-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
    JNK2 Rabbit Polyclonal Antibody
    ABP57571-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
    JNK3 Rabbit Polyclonal Antibody
    ABP57572-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
    JNK3 Rabbit Polyclonal Antibody
    ABP57572-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
    JNK3 Rabbit Polyclonal Antibody
    ABP57572-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
    MEK2 Rabbit Polyclonal Antibody
    ABP57573-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
    MEK2 Rabbit Polyclonal Antibody
    ABP57573-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
    MEK2 Rabbit Polyclonal Antibody
    ABP57573-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
    MEK3 Rabbit Polyclonal Antibody
    ABP57574-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
    MEK3 Rabbit Polyclonal Antibody
    ABP57574-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
    MEK3 Rabbit Polyclonal Antibody
    ABP57574-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
    Nrf2 Rabbit Polyclonal Antibody
    ABP57575-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
    Nrf2 Rabbit Polyclonal Antibody
    ABP57575-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
    Nrf2 Rabbit Polyclonal Antibody
    ABP57575-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
    ATG4a Rabbit Polyclonal Antibody
    ABP57576-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
    ATG4a Rabbit Polyclonal Antibody
    ABP57576-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

    RAMP3 Rabbit Polyclonal Antibody