RAMP1 Rabbit Polyclonal Antibody

RAMP1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

RAMP1 Polyclonal Antibody

ABP60084-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RAMP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RAMP1 from Human, Mouse, Rat. This RAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAMP1 protein

RAMP1 Polyclonal Antibody

ABP60084-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RAMP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RAMP1 from Human, Mouse, Rat. This RAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAMP1 protein

RAMP1 Polyclonal Antibody

ABP60084-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAMP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RAMP1 from Human, Mouse, Rat. This RAMP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAMP1 protein

RAMP1 Rabbit pAb

A6447-100ul 100 ul
EUR 308

RAMP1 Rabbit pAb

A6447-200ul 200 ul
EUR 459

RAMP1 Rabbit pAb

A6447-20ul 20 ul
EUR 183

RAMP1 Rabbit pAb

A6447-50ul 50 ul
EUR 223

Polyclonal RAMP1 (extracellular) Antibody

APR13064G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAMP1 (extracellular) . This antibody is tested and proven to work in the following applications:

RAMP1 Antibody

ABD8597 100 ug
EUR 438

RAMP1 Antibody

35885-100ul 100ul
EUR 252

RAMP1 antibody

38925-100ul 100ul
EUR 252

RAMP1 antibody

22090-100ul 100ul
EUR 390

RAMP1 antibody

70R-19757 50 ul
EUR 435
Description: Rabbit polyclonal RAMP1 antibody

RAMP1 antibody

70R-13202 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RAMP1 antibody

RAMP1 Antibody

DF8597 200ul
EUR 304
Description: RAMP1 Antibody detects endogenous levels of total RAMP1.

RAMP1 Antibody

1-CSB-PA995687
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAMP1. Recognizes RAMP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:10-1:50

RAMP1 Antibody

1-CSB-PA019304GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAMP1. Recognizes RAMP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Ramp1/ Rat Ramp1 ELISA Kit

ELI-44293r 96 Tests
EUR 886

RAMP1 Conjugated Antibody

C38925 100ul
EUR 397

RAMP1 Conjugated Antibody

C35885 100ul
EUR 397

anti- RAMP1 antibody

FNab07097 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: receptor(G protein-coupled) activity modifying protein 1
  • Uniprot ID: O60894
  • Gene ID: 10267
  • Research Area: Signal Transduction
Description: Antibody raised against RAMP1

Anti-RAMP1 antibody

PAab07097 100 ug
EUR 412

Anti-RAMP1 antibody

STJ28530 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP1) protein, CRLR functions as a CGRP receptor. The RAMP1 protein is involved in the terminal glycosylation, maturation, and presentation of the CGRP receptor to the cell surface. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-RAMP1 antibody

STJ193090 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAMP1

RAMP1 siRNA

20-abx904458
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAMP1 siRNA

20-abx930840
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAMP1 siRNA

20-abx930841
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-RAMP1

PVT18751 2 ug
EUR 231

anti-RAMP1

YF-PA25528 50 ul
EUR 334
Description: Mouse polyclonal to RAMP1

Polyclonal Goat Anti-Ramp1 (C-Term., mouse) Antibody

AMM05953G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Ramp1 (C-Term., mouse) . This antibody is tested and proven to work in the following applications:

RAMP1 cloning plasmid

CSB-CL019304HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 447
  • Sequence: atggcccgggccctgtgccgcctcccgcggcgcggcctctggctgctcctggcccatcacctcttcatgaccactgcctgccaggaggctaactacggtgccctcctccgggagctctgcctcacccagttccaggtagacatggaggccgtcggggagacgctgtggtgtgactg
  • Show more
Description: A cloning plasmid for the RAMP1 gene.

RAMP1 Blocking Peptide

20-abx161402
  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RAMP1 Blocking Peptide

DF8597-BP 1mg
EUR 195

Anti-RAMP1 (1F1)

YF-MA17226 100 ug
EUR 363
Description: Mouse monoclonal to RAMP1

Anti-RAMP1 (3B9)

YF-MA20491 100 ug
EUR 363
Description: Mouse monoclonal to RAMP1

Mouse RAMP1 shRNA Plasmid

20-abx974187
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RAMP1 shRNA Plasmid

20-abx985944
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAMP1 ELISA KIT|Human

EF007381 96 Tests
EUR 689

Human RAMP1 shRNA Plasmid

20-abx956950
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAMP1 protein (His tag)

80R-3651 50 ug
EUR 435
Description: Purified recombinant RAMP1 protein (His tag)

RAMP1 Recombinant Protein (Human)

RP025717 100 ug Ask for price

RAMP1 Recombinant Protein (Rat)

RP223553 100 ug Ask for price

RAMP1 Recombinant Protein (Mouse)

RP166682 100 ug Ask for price

RAMP1 Recombinant Protein (Mouse)

RP166685 100 ug Ask for price

RAMP1 Recombinant Protein (Mouse)

RP166688 100 ug Ask for price

Anti-Ramp1 (C-Term., mouse) antibody

STJ71612 100 µg
EUR 359

Monoclonal RAMP1 Antibody (monoclonal) (M01), Clone: 1F1

APR13065G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RAMP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1F1. This antibody is applicable in E

Receptor Activity Modifying Protein 1 (RAMP1) Antibody

20-abx115081
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Activity Modifying Protein 1 (RAMP1) Antibody

20-abx121692
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Receptor Activity Modifying Protein 1 (RAMP1) Antibody

20-abx004940
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Receptor Activity Modifying Protein 1 (Ramp1) Antibody

abx431959-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Receptor Activity Modifying Protein 1 (RAMP1) Antibody

abx237097-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Receptor Activity Modifying Protein 1 (RAMP1) Antibody

20-abx211682
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAMP1 ORF Vector (Human) (pORF)

ORF008573 1.0 ug DNA
EUR 95

Ramp1 ORF Vector (Rat) (pORF)

ORF074519 1.0 ug DNA
EUR 506

Ramp1 ORF Vector (Mouse) (pORF)

ORF055562 1.0 ug DNA
EUR 506

Ramp1 ORF Vector (Mouse) (pORF)

ORF055563 1.0 ug DNA
EUR 506

Ramp1 ORF Vector (Mouse) (pORF)

ORF055564 1.0 ug DNA
EUR 506

Rabbit Anti-Human Receptor Activity Modifying Protein 1 (RAMP1) antiserum #1

RAMP11-S 100 ul
EUR 457

RAMP1 sgRNA CRISPR Lentivector set (Human)

K1783101 3 x 1.0 ug
EUR 339

Ramp1 sgRNA CRISPR Lentivector set (Mouse)

K5029701 3 x 1.0 ug
EUR 339

Ramp1 sgRNA CRISPR Lentivector set (Rat)

K6866501 3 x 1.0 ug
EUR 339

RAMP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1783102 1.0 ug DNA
EUR 154

RAMP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1783103 1.0 ug DNA
EUR 154

RAMP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1783104 1.0 ug DNA
EUR 154

Ramp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5029702 1.0 ug DNA
EUR 154

Ramp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5029703 1.0 ug DNA
EUR 154

Ramp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5029704 1.0 ug DNA
EUR 154

Ramp1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6866502 1.0 ug DNA
EUR 154

Ramp1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6866503 1.0 ug DNA
EUR 154

Ramp1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6866504 1.0 ug DNA
EUR 154

Recombinant Human RAMP1 Protein, His, E.coli-10ug

QP13259-10ug 10ug
EUR 201

Recombinant Human RAMP1 Protein, His, E.coli-1mg

QP13259-1mg 1mg
EUR 5251

Recombinant Human RAMP1 Protein, His, E.coli-2ug

QP13259-2ug 2ug
EUR 155

RAMP1 Protein Vector (Human) (pPB-C-His)

PV034289 500 ng
EUR 329

RAMP1 Protein Vector (Human) (pPB-N-His)

PV034290 500 ng
EUR 329

RAMP1 Protein Vector (Human) (pPM-C-HA)

PV034291 500 ng
EUR 329

RAMP1 Protein Vector (Human) (pPM-C-His)

PV034292 500 ng
EUR 329

RAMP1 Protein Vector (Rat) (pPB-C-His)

PV298074 500 ng
EUR 603

RAMP1 Protein Vector (Rat) (pPB-N-His)

PV298075 500 ng
EUR 603

RAMP1 Protein Vector (Rat) (pPM-C-HA)

PV298076 500 ng
EUR 603

RAMP1 Protein Vector (Rat) (pPM-C-His)

PV298077 500 ng
EUR 603

RAMP1 Protein Vector (Mouse) (pPB-C-His)

PV222246 500 ng
EUR 603

RAMP1 Protein Vector (Mouse) (pPB-N-His)

PV222247 500 ng
EUR 603

RAMP1 Protein Vector (Mouse) (pPM-C-HA)

PV222248 500 ng
EUR 603

RAMP1 Protein Vector (Mouse) (pPM-C-His)

PV222249 500 ng
EUR 603

RAMP1 Protein Vector (Mouse) (pPB-C-His)

PV222250 500 ng
EUR 603

RAMP1 Protein Vector (Mouse) (pPB-N-His)

PV222251 500 ng
EUR 603

RAMP1 Protein Vector (Mouse) (pPM-C-HA)

PV222252 500 ng
EUR 603

RAMP1 Protein Vector (Mouse) (pPM-C-His)

PV222253 500 ng
EUR 603

RAMP1 Protein Vector (Mouse) (pPB-C-His)

PV222254 500 ng
EUR 603

RAMP1 Protein Vector (Mouse) (pPB-N-His)

PV222255 500 ng
EUR 603

RAMP1 Protein Vector (Mouse) (pPM-C-HA)

PV222256 500 ng
EUR 603

RAMP1 Protein Vector (Mouse) (pPM-C-His)

PV222257 500 ng
EUR 603

Ramp1 3'UTR GFP Stable Cell Line

TU167509 1.0 ml Ask for price

RAMP1 3'UTR Luciferase Stable Cell Line

TU019484 1.0 ml
EUR 1394

Ramp1 3'UTR Luciferase Stable Cell Line

TU117509 1.0 ml Ask for price

RAMP1 3'UTR GFP Stable Cell Line

TU069484 1.0 ml
EUR 1394

Ramp1 3'UTR GFP Stable Cell Line

TU267282 1.0 ml Ask for price

Ramp1 3'UTR Luciferase Stable Cell Line

TU217282 1.0 ml Ask for price

Rabbit Anti-Human Receptor Activity Modifying Protein 1 (RAMP1) IgG #1, aff. pure

RAMP11-A 100 ug
EUR 482

RAMP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV693373 1.0 ug DNA
EUR 514

RAMP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV693377 1.0 ug DNA
EUR 514

RAMP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV693378 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

RAMP1 Rabbit Polyclonal Antibody