RAB14 Rabbit Polyclonal Antibody

RAB14 Rabbit Polyclonal Antibody

Contact Us Below To Order :

RAB14 Rabbit pAb

A12752-100ul 100 ul
EUR 308

RAB14 Rabbit pAb

A12752-200ul 200 ul
EUR 459

RAB14 Rabbit pAb

A12752-20ul 20 ul
EUR 183

RAB14 Rabbit pAb

A12752-50ul 50 ul
EUR 223

RAB14 antibody

70R-51381 100 ul
EUR 244
Description: Purified Polyclonal RAB14 antibody

RAB14 Antibody

37854-100ul 100ul
EUR 252

RAB14 antibody

70R-19686 50 ul
EUR 435
Description: Rabbit polyclonal RAB14 antibody

RAB14 antibody

70R-10565 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RAB14 antibody

RAB14 Antibody

DF12460 200ul
EUR 304
Description: RAB14 antibody detects endogenous levels of RAB14.

RAB14 Antibody

1-CSB-PA793696
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB14. Recognizes RAB14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:300

RAB14 Antibody

1-CSB-PA019162GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB14. Recognizes RAB14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RAB14 Conjugated Antibody

C37854 100ul
EUR 397

anti- RAB14 antibody

FNab06996 100µg
EUR 505.25
  • Immunogen: RAB14, member RAS oncogene family
  • Uniprot ID: P61106
  • Gene ID: 51552
  • Research Area: Signal Transduction
Description: Antibody raised against RAB14

Anti-RAB14 Antibody

PB9815 100ug/vial
EUR 294

Anti-RAB14 antibody

PAab06996 100 ug
EUR 355

Anti-RAB14 antibody

STJ114625 100 µl
EUR 277

Anti-Rab14 antibody

STJ140070 100 µg
EUR 219
Description: RAB14 belongs to the large RAB family of low molecular weight GTPases that are involved in intracellular membrane trafficking. This protein is expressed at high levels in kidney, lung, brain, spleen and thymus and it is thought to be involved in vesicular trafficking and neurotransmitter release. It is also involved in the biosynthetic/recycling pathway between the Golgi and endosomal compartments.

Anti-Rab14 antibody

STJ140071 100 µg
EUR 219
Description: RAB14 belongs to the large RAB family of low molecular weight GTPases that are involved in intracellular membrane trafficking. This protein is expressed at high levels in kidney, lung, brain, spleen and thymus and it is thought to be involved in vesicular trafficking and neurotransmitter release. It is also involved in the biosynthetic/recycling pathway between the Golgi and endosomal compartments.

Anti-RAB14 antibody

STJ193089 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB14

Rab14/ Rat Rab14 ELISA Kit

ELI-52479r 96 Tests
EUR 886

RAB14 siRNA

20-abx904412
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB14 siRNA

20-abx930601
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB14 siRNA

20-abx930602
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB14 cloning plasmid

CSB-CL019162HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atggcaactgcaccatacaactactcttacatctttaaatatattattattggggacatgggagtaggaaaatcttgcttgcttcatcaatttacagaaaaaaaatttatggctgattgtcctcacacaattggtgttgaatttggtacaagaataatcgaagttagtggccaaaa
  • Show more
Description: A cloning plasmid for the RAB14 gene.

RAB14 Blocking Peptide

20-abx064256
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RAB14 Blocking Peptide

33R-2956 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB14 antibody, catalog no. 70R-10565

RAB14 Blocking Peptide

DF12460-BP 1mg
EUR 195

Monoclonal RAB14 Antibody, Clone: 1779CT692.32.86

AMM07435G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human RAB14. The antibodies are raised in Mouse and are from clone 1779CT692.32.86. This antibody is applicable in WB, E

Rab14, Member Ras Oncogene Family Antibody

20-abx114964
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse RAB14 shRNA Plasmid

20-abx976596
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RAB14 shRNA Plasmid

20-abx987085
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB14 ELISA Kit

ELA-E14990h 96 Tests
EUR 824

RAB14 ELISA KIT|Human

EF005847 96 Tests
EUR 689

Human RAB14 shRNA Plasmid

20-abx959827
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB14 protein (His tag)

80R-1866 50 ug
EUR 305
Description: Purified recombinant RAB14 protein

RAB14 Recombinant Protein (Human)

RP025417 100 ug Ask for price

RAB14 Recombinant Protein (Rat)

RP223250 100 ug Ask for price

RAB14 Recombinant Protein (Mouse)

RP166196 100 ug Ask for price

Rabbit Ras related protein Rab 14(RAB14) ELISA kit

E04R0379-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ras related protein Rab 14(RAB14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ras related protein Rab 14(RAB14) ELISA kit

E04R0379-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ras related protein Rab 14(RAB14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ras related protein Rab 14(RAB14) ELISA kit

E04R0379-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Ras related protein Rab 14(RAB14) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Ras-Related Protein Rab-14 (RAB14) Antibody

abx036226-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-14 (RAB14) Antibody

20-abx007777
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ras-related protein Rab-14 (RAB14) Antibody

20-abx214234
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-14 (RAB14) Antibody

abx236996-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

RAB14 ORF Vector (Human) (pORF)

ORF008473 1.0 ug DNA
EUR 95

Rab14 ORF Vector (Rat) (pORF)

ORF074418 1.0 ug DNA
EUR 506

Rab14 ORF Vector (Mouse) (pORF)

ORF055400 1.0 ug DNA
EUR 506

RAB14, Member RAS Oncogene Family Protein

20-abx262905
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

RAB14 sgRNA CRISPR Lentivector set (Human)

K1771801 3 x 1.0 ug
EUR 339

Rab14 sgRNA CRISPR Lentivector set (Mouse)

K4613501 3 x 1.0 ug
EUR 339

Rab14 sgRNA CRISPR Lentivector set (Rat)

K7050301 3 x 1.0 ug
EUR 339

Recombinant Human RAB14, Member RAS Oncogene Family

7-06007 2µg Ask for price

Recombinant Human RAB14, Member RAS Oncogene Family

7-06008 10µg Ask for price

Recombinant Human RAB14, Member RAS Oncogene Family

7-06009 1mg Ask for price

RAB14 sgRNA CRISPR Lentivector (Human) (Target 1)

K1771802 1.0 ug DNA
EUR 154

RAB14 sgRNA CRISPR Lentivector (Human) (Target 2)

K1771803 1.0 ug DNA
EUR 154

RAB14 sgRNA CRISPR Lentivector (Human) (Target 3)

K1771804 1.0 ug DNA
EUR 154

Rab14 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4613502 1.0 ug DNA
EUR 154

Rab14 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4613503 1.0 ug DNA
EUR 154

Rab14 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4613504 1.0 ug DNA
EUR 154

Rab14 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7050302 1.0 ug DNA
EUR 154

Rab14 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7050303 1.0 ug DNA
EUR 154

Rab14 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7050304 1.0 ug DNA
EUR 154

Recombinant Human RAB14 Protein, His, E.coli-10ug

QP13230-10ug 10ug
EUR 201

Recombinant Human RAB14 Protein, His, E.coli-1mg

QP13230-1mg 1mg
EUR 5251

Recombinant Human RAB14 Protein, His, E.coli-2ug

QP13230-2ug 2ug
EUR 155

RAB14 Protein Vector (Human) (pPB-C-His)

PV033889 500 ng
EUR 329

RAB14 Protein Vector (Human) (pPB-N-His)

PV033890 500 ng
EUR 329

RAB14 Protein Vector (Human) (pPM-C-HA)

PV033891 500 ng
EUR 329

RAB14 Protein Vector (Human) (pPM-C-His)

PV033892 500 ng
EUR 329

RAB14 Protein Vector (Rat) (pPB-C-His)

PV297670 500 ng
EUR 603

RAB14 Protein Vector (Rat) (pPB-N-His)

PV297671 500 ng
EUR 603

RAB14 Protein Vector (Rat) (pPM-C-HA)

PV297672 500 ng
EUR 603

RAB14 Protein Vector (Rat) (pPM-C-His)

PV297673 500 ng
EUR 603

RAB14 Protein Vector (Mouse) (pPB-C-His)

PV221598 500 ng
EUR 603

RAB14 Protein Vector (Mouse) (pPB-N-His)

PV221599 500 ng
EUR 603

RAB14 Protein Vector (Mouse) (pPM-C-HA)

PV221600 500 ng
EUR 603

RAB14 Protein Vector (Mouse) (pPM-C-His)

PV221601 500 ng
EUR 603

Rab14 3'UTR GFP Stable Cell Line

TU167391 1.0 ml Ask for price

RAB14 3'UTR Luciferase Stable Cell Line

TU019368 1.0 ml
EUR 2333

Rab14 3'UTR Luciferase Stable Cell Line

TU117391 1.0 ml Ask for price

RAB14 3'UTR GFP Stable Cell Line

TU069368 1.0 ml
EUR 2333

Rab14 3'UTR GFP Stable Cell Line

TU267176 1.0 ml Ask for price

Rab14 3'UTR Luciferase Stable Cell Line

TU217176 1.0 ml Ask for price

RAB14 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV675397 1.0 ug DNA
EUR 514

RAB14 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV675401 1.0 ug DNA
EUR 514

RAB14 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV675402 1.0 ug DNA
EUR 514

RAB14, Member RAS Oncogene Family Human Recombinant Protein

PROTP61106 Regular: 10ug
EUR 317
Description: RAB14 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 238 amino acids (1-215) and having a molecular mass of 26.3 kDa.;The RAB14 is fused to a 23 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

RAB14 Rabbit Polyclonal Antibody