NOX4 Rabbit Polyclonal Antibody

NOX4 Rabbit Polyclonal Antibody

Contact Us Below To Order :

NOX4 Polyclonal Antibody

ABP59498-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NOX4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NOX4 from Human, Mouse, Rat. This NOX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOX4 protein

NOX4 Polyclonal Antibody

ABP59498-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NOX4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NOX4 from Human, Mouse, Rat. This NOX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOX4 protein

NOX4 Polyclonal Antibody

ABP59498-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NOX4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NOX4 from Human, Mouse, Rat. This NOX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOX4 protein

NOX4 Polyclonal Antibody

ES11921-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NOX4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOX4 Polyclonal Antibody

ES11921-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NOX4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOX4 Rabbit pAb

A11274-100ul 100 ul
EUR 308

NOX4 Rabbit pAb

A11274-200ul 200 ul
EUR 459

NOX4 Rabbit pAb

A11274-20ul 20 ul
EUR 183

NOX4 Rabbit pAb

A11274-50ul 50 ul
EUR 223

NOX4 Rabbit mAb

A3656-100ul 100 ul
EUR 410

NOX4 Rabbit mAb

A3656-200ul 200 ul
EUR 571

NOX4 Rabbit mAb

A3656-20ul 20 ul
EUR 221

NOX4 Rabbit mAb

A3656-50ul 50 ul
EUR 287

Anti-NOX4 Rabbit Monoclonal Antibody

M00403 100ug/vial
EUR 397
Description: Rabbit Monoclonal NOX4 Antibody. Validated in IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Rabbit NOX4 ELISA Kit

ERTN0050 96Tests
EUR 521

Polyclonal NOX4 Antibody (N-Terminus)

APR08788G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOX4 (N-Terminus). This antibody is tested and proven to work in the following applications:

NOX4 Polyclonal Antibody, HRP Conjugated

A63035 100 µg
EUR 570.55
Description: reagents widely cited

NOX4 Polyclonal Antibody, FITC Conjugated

A63036 100 µg
EUR 570.55
Description: Ask the seller for details

NOX4 Polyclonal Antibody, Biotin Conjugated

A63037 100 µg
EUR 570.55
Description: The best epigenetics products

Nox4 Polyclonal Antibody, Biotin Conjugated

A54536 100 µg
EUR 570.55
Description: reagents widely cited

Nox4 Polyclonal Antibody, FITC Conjugated

A54537 100 µg
EUR 570.55
Description: Ask the seller for details

Nox4 Polyclonal Antibody, HRP Conjugated

A54538 100 µg
EUR 570.55
Description: The best epigenetics products

NOX4 antibody

70R-18930 50 ul
EUR 435
Description: Rabbit polyclonal NOX4 antibody

NOX4 Antibody

32663-100ul 100ul
EUR 252

NOX4 Antibody

1-CSB-PA777165
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

NOX4 Antibody

DF6924 200ul
EUR 304
Description: NOX4 Antibody detects endogenous levels of total NOX4.

NOX4 Antibody

1-CSB-PA015961GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

NOX4 Antibody

1-CSB-PA015961LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Nox4 Antibody

1-CSB-PA015961LA01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat, Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

NOX4 Antibody

1-CSB-PA034129
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

NOX4 antibody

70R-50972 100 ul
EUR 244
Description: Purified Polyclonal NOX4 antibody

NOX4 Antibody

ABD6924 100 ug
EUR 438

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Hu-48T 48T
EUR 498
  • Should the Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Hu-96T 96T
EUR 647
  • Should the Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Mu-48T 48T
EUR 508
  • Should the Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Mu-96T 96T
EUR 661
  • Should the Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Ra-48T 48T
EUR 528
  • Should the Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Ra-96T 96T
EUR 690
  • Should the Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Hu-48Tests 48 Tests
EUR 522

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Hu-96Tests 96 Tests
EUR 724

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Mu-48Tests 48 Tests
EUR 534

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Mu-96Tests 96 Tests
EUR 742

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Ra-48Tests 48 Tests
EUR 558

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Ra-96Tests 96 Tests
EUR 776

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Hu-48Tests 48 Tests
EUR 500

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Hu-96Tests 96 Tests
EUR 692

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Mu-48Tests 48 Tests
EUR 511

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Mu-96Tests 96 Tests
EUR 709

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Ra-48Tests 48 Tests
EUR 534

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Ra-96Tests 96 Tests
EUR 742

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNUM1245-50 50uL
EUR 395
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245), 1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNUB1245-100 100uL
EUR 209
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245), Concentration: 0.2mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNUB1245-500 500uL
EUR 458
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245), Concentration: 0.2mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC551245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF555 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC551245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF555 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC611245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF660R conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC611245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF660R conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC471245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF647 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC471245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF647 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC051245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405M conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC051245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405M conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC401245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF640R conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC401245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF640R conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC431245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF543 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC431245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF543 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC041245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405S conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC041245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405S conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC801245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC801245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCP1245-250 250uL
EUR 383
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),PerCP conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCR1245-250 250uL
EUR 383
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),RPE conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCA1245-250 250uL
EUR 383
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),APC conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCB1245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Biotin conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCB1245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Biotin conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCH1245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCH1245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC881245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF488A conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC881245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF488A conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC941245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF594 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC941245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF594 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC681245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF568 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC681245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF568 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC701245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF770 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC701245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF770 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCAP1245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCAP1245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC811245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680R conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC811245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680R conjugate, Concentration: 0.1mg/mL

NOX4 Conjugated Antibody

C32663 100ul
EUR 397

anti- NOX4 antibody

FNab05806 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:100-1:400
  • IF: 1:10-1:100
  • Immunogen: NADPH oxidase 4
  • Uniprot ID: Q9NPH5
  • Gene ID: 50507
  • Research Area: Metabolism
Description: Antibody raised against NOX4

Anti-NOX4 antibody

PAab05806 100 ug
EUR 386

Anti-NOX4 antibody

STJ24791 100 µl
EUR 277
Description: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.

Anti-NOX4 antibody

STJ113053 100 µl
EUR 277
Description: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.

Anti-NOX4 antibody

STJ193079 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NOX4

Rabbit Anti-NOX4 monoclonal antibody, clone TZ1325

CABT-38500RH 100 ul
EUR 777

Nox4/ Rat Nox4 ELISA Kit

ELI-04894r 96 Tests
EUR 886

NOX4 siRNA

20-abx903611
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOX4 siRNA

20-abx926191
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOX4 siRNA

20-abx926192
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOX4 Antibody, HRP conjugated

1-CSB-PA015961LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Nox4 Antibody, HRP conjugated

1-CSB-PA015961LB01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

NOX4 Antibody, FITC conjugated

1-CSB-PA015961LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

Nox4 Antibody, FITC conjugated

1-CSB-PA015961LC01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

NOX4 Antibody, Biotin conjugated

1-CSB-PA015961LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Nox4 Antibody, Biotin conjugated

1-CSB-PA015961LD01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

NOX4 recombinant monoclonal antibody

A5258 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human NOX4 for WB, IHC, IF,ELISA

Rabbit NADPH Oxidase 4 (NOX4) ELISA Kit

abx363460-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

NADPH oxidase 4/NOX4 Antibody

48782-100ul 100ul
EUR 333

NADPH oxidase 4/NOX4 Antibody

48782-50ul 50ul
EUR 239

NADPH Oxidase 4 (NOX4) Antibody

20-abx008166
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx027743-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx027743-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx016156-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx214042
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx216479-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx224134-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx110460
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx114020
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx125425-50ul 50 ul
EUR 411
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx126267
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx146310-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx241251
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Monoclonal NOX4 Antibody, Clone: 3H2C4

APR08785G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human NOX4. The antibodies are raised in Mouse and are from clone 3H2C4. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal NOX4 Antibody, Clone: 3H2G11

APR08786G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human NOX4. The antibodies are raised in Mouse and are from clone 3H2G11. This antibody is applicable in WB and IHC, FC, ICC, E

NADPH Oxidase 4 (NOX4) Antibody

abx235806-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx301944
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx001813
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

NOX4 Blocking Peptide

DF6924-BP 1mg
EUR 195

NOX4 Blocking Peptide

20-abx063847
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

NOX4 cloning plasmid

CSB-CL015961HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1737
  • Sequence: atggctgtgtcctggaggagctggctcgccaacgaaggggttaaacacctctgcctgttcatctggctctccatgaatgtcctgcttttctggaaaaccttcttgctgtataaccaagggccagagtatcactacctccaccagatgttggggctaggattgtgtctaagcagag
  • Show more
Description: A cloning plasmid for the NOX4 gene.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human)

4-PAB924Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4)

Anti-NADPH oxidase 4/NOX4 Antibody

A00403 100ug/vial
EUR 334

NADPH Oxidase 4 (NOX4) Antibody (Biotin)

20-abx106181
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody (FITC)

20-abx107595
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody (HRP)

20-abx109013
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH oxidase 4/NOX4 Conjugated Antibody

C48782 100ul
EUR 397

NADPH Oxidase 4 (NOX4) Antibody (HRP)

20-abx304654
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody (FITC)

20-abx304655
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NOX4 Rabbit Polyclonal Antibody