MYH9 Rabbit Polyclonal Antibody

MYH9 Rabbit Polyclonal Antibody

Contact Us Below To Order :

MYH9 Polyclonal Antibody

ABP59367-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MYH9 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MYH9 from Human, Mouse, Rat. This MYH9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH9 protein

MYH9 Polyclonal Antibody

ABP59367-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MYH9 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MYH9 from Human, Mouse, Rat. This MYH9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH9 protein

MYH9 Polyclonal Antibody

ES11920-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MYH9 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYH9 Polyclonal Antibody

ES11920-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MYH9 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYH9 Rabbit pAb

A0173-100ul 100 ul
EUR 308

MYH9 Rabbit pAb

A0173-200ul 200 ul
EUR 459

MYH9 Rabbit pAb

A0173-20ul 20 ul
EUR 183

MYH9 Rabbit pAb

A0173-50ul 50 ul
EUR 223

MYH9 Rabbit pAb

A16923-100ul 100 ul
EUR 308

MYH9 Rabbit pAb

A16923-200ul 200 ul
EUR 459

MYH9 Rabbit pAb

A16923-20ul 20 ul
EUR 183

MYH9 Rabbit pAb

A16923-50ul 50 ul
EUR 223

Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit

DLR-MYH9-Hu-48T 48T
EUR 517
  • Should the Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Heavy Chain 9, Non Muscle (MYH9) in samples from serum, plasma or other biological fluids.

Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit

DLR-MYH9-Hu-96T 96T
EUR 673
  • Should the Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Heavy Chain 9, Non Muscle (MYH9) in samples from serum, plasma or other biological fluids.

Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit

RDR-MYH9-Hu-48Tests 48 Tests
EUR 544

Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit

RDR-MYH9-Hu-96Tests 96 Tests
EUR 756

Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit

RD-MYH9-Hu-48Tests 48 Tests
EUR 521

Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit

RD-MYH9-Hu-96Tests 96 Tests
EUR 723

MYH9 antibody

70R-18705 50 ul
EUR 435
Description: Rabbit polyclonal MYH9 antibody

MYH9 antibody

70R-2739 50 ug
EUR 467
Description: Rabbit polyclonal MYH9 antibody raised against the middle region of MYH9

MYH9 Antibody

45364-100ul 100ul
EUR 252

MYH9 Antibody

45364-50ul 50ul
EUR 187

MYH9 Antibody

DF8574 200ul
EUR 304
Description: MYH9 Antibody detects endogenous levels of total MYH9.

MYH9 Antibody

1-CSB-PA015303GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MYH9. Recognizes MYH9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

MYH9 Antibody

1-CSB-PA01405A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYH9. Recognizes MYH9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MYH9 antibody

70R-51307 100 ul
EUR 244
Description: Purified Polyclonal MYH9 antibody

MYH9 Antibody

ABD8574 100 ug
EUR 438

Polyclonal Phospho-MYH9(Y158) Antibody

APR14366G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-MYH9(Y158) . This antibody is tested and proven to work in the following applications:

Polyclonal MYH9 Antibody (internal region)

APR17492G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MYH9 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal MYH9 Antibody (C-term)

APR17493G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYH9 (C-term). This antibody is tested and proven to work in the following applications:

MYH9 Polyclonal Antibody, HRP Conjugated

A53890 100 µg
EUR 570.55
Description: fast delivery possible

MYH9 Polyclonal Antibody, FITC Conjugated

A53891 100 µg
EUR 570.55
Description: reagents widely cited

MYH9 Polyclonal Antibody, Biotin Conjugated

A53892 100 µg
EUR 570.55
Description: Ask the seller for details

Polyclonal MYH9 Antibody (N-term Y158)

APR17498G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYH9 (N-term Y158). This antibody is tested and proven to work in the following applications:

Phospho-MYH9-S1943 Rabbit pAb

AP0802-100ul 100 ul
EUR 384

Phospho-MYH9-S1943 Rabbit pAb

AP0802-200ul 200 ul
EUR 554

Phospho-MYH9-S1943 Rabbit pAb

AP0802-20ul 20 ul
EUR 183

Phospho-MYH9-S1943 Rabbit pAb

AP0802-50ul 50 ul
EUR 265

MYH9 (pY158) Antibody

abx032117-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

MYH9 (pY158) Antibody

abx032117-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

MYH9 Conjugated Antibody

C45364 100ul
EUR 397

anti- MYH9 antibody

FNab05479 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: myosin, heavy chain 9, non-muscle
  • Uniprot ID: P35579
  • Gene ID: 4627
  • Research Area: Immunology, Developmental biology
Description: Antibody raised against MYH9

anti- Myh9 antibody

FNab05480 100µg
EUR 585
  • Recommended dilution: WB : 1:500-1:2000
  • IHC : 1:20-1:200
  • IF : 1:50-1:500
  • Immunogen: myosin, heavy polypeptide 9, non-muscle
  • Uniprot ID: P35579
  • Gene ID: 4627
  • Research Area: Immunology, Developmental biology
Description: Antibody raised against Myh9

anti- Myh9 antibody

FNab05481 100µg
EUR 585
  • Immunogen: myosin, heavy polypeptide 9, non-muscle
  • Uniprot ID: Q8VDD5
  • Gene ID: 17886
  • Research Area: Immunology, Developmental biology
Description: Antibody raised against Myh9

anti- MYH9 antibody

FNab05482 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:5000
  • Immunogen: myosin, heavy chain 9, non-muscle
  • Uniprot ID: P35579
  • Gene ID: 4627
  • Research Area: Immunology, Developmental biology
Description: Antibody raised against MYH9

Anti-MYH9 antibody

PAab05479 100 ug
EUR 355

Anti-Myh9 antibody

PAab05480 100 ug
EUR 412

Anti-Myh9 antibody

PAab05481 100 ug
EUR 412

Anti-MYH9 antibody

STJ24664 100 µl
EUR 277
Description: This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness.

Anti-MYH9 antibody

STJ119260 100 µl
EUR 277

Anti-MYH9 antibody

STJ193078 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MYH9

Anti-MYH9 antibody

STJ73316 100 µg
EUR 359

MYH9 protein

30R-3272 50 ug
EUR 257
Description: Purified recombinant MYH9 protein

MYH9 siRNA

20-abx903417
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYH9 siRNA

20-abx925159
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYH9 siRNA

20-abx925160
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-MYH9

PVT17683 2 ug
EUR 231

MYH9 Antibody, HRP conjugated

1-CSB-PA01405B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYH9. Recognizes MYH9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MYH9 Antibody, FITC conjugated

1-CSB-PA01405C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYH9. Recognizes MYH9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MYH9 Antibody, Biotin conjugated

1-CSB-PA01405D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYH9. Recognizes MYH9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MYH9 Blocking Peptide

33R-1860 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MYH9 antibody, catalog no. 70R-2739

MYH9 Blocking Peptide

DF8574-BP 1mg
EUR 195

MYH9 cloning plasmid

CSB-CL015303HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 429
  • Sequence: atggcaaagcggatggggctgaggccaaacctgccgaataagcctcttctcctgcagcctgagatggatggacagacagacaccacagcctccccttcccagaccccgcagcacgcctctccccaccttcttgggactgctgtgaacatgcctcctcctgccctccgccccgtccc
  • Show more
Description: A cloning plasmid for the MYH9 gene.

anti-MYH9 (3C7)

LF-MA10200 50 ug
EUR 363
Description: Mouse monoclonal to MYH9

Anti-Phospho-MYH9-(S1943) antibody

STJ117900 100 µl
EUR 393
Description: This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness.

Human Myosin-9 (MYH9)

1-CSB-RP014054h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Myosin-9(MYH9) ,partial expressed in E.coli

Human MYH9 ELISA Kit

ELA-E0237h 96 Tests
EUR 824

MYH9 ELISA KIT|Human

EF000516 96 Tests
EUR 689

Mouse MYH9 shRNA Plasmid

20-abx971649
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat MYH9 shRNA Plasmid

20-abx985273
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MYH9 shRNA Plasmid

20-abx953054
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal MYH9 Antibody (clone 2B3), Clone: 2B3

APR17494G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human MYH9 (clone 2B3). The antibodies are raised in Mouse and are from clone 2B3. This antibody is applicable in WB and IHC-P, IF, E

Monoclonal MYH9 Antibody (clone 4H3), Clone: 4H3

APR17495G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human MYH9 (clone 4H3). The antibodies are raised in Mouse and are from clone 4H3. This antibody is applicable in WB and IHC-P, IF, E

Monoclonal MYH9 Antibody (monoclonal) (M05), Clone: 1H6

APR17496G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human MYH9 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 1H6. This antibody is applicable in WB and IF, E

Monoclonal MYH9 Antibody (monoclonal) (M06), Clone: 4H3

APR17497G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human MYH9 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 4H3. This antibody is applicable in WB, IHC and IF, E

Rabbit Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit

abx363683-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Myh9 ORF Vector (Rat) (pORF)

ORF070986 1.0 ug DNA
EUR 2080

MYH9 ORF Vector (Human) (pORF)

ORF006827 1.0 ug DNA
EUR 95

Myh9 ORF Vector (Mouse) (pORF)

ORF050865 1.0 ug DNA
EUR 1572

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

20-abx217007
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

20-abx177681
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

20-abx110021
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

20-abx113947
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

20-abx173685
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

abx030030-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

abx030030-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

abx235479-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Myosin Heavy Chain 9, Non Muscle (Myh9) Antibody

abx235480-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Myosin Heavy Chain 9, Non Muscle (Myh9) Antibody

abx235481-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

abx235482-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

abx433004-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

20-abx000580
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dog MYH9/ Myosin-9 ELISA Kit

E0077Do 1 Kit
EUR 717

Human MYH9/ Myosin-9 ELISA Kit

E1692Hu 1 Kit
EUR 571

Human MYH9(Myosin-9) ELISA Kit

EH0791 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P35579
  • Alias: MYH9(Myosin Heavy Chain 9, Non Muscle)/MHA/FTNS/EPSTS/Myosin-9/Non-muscle myosin heavy chain Iia/Myosin heavy chain 9/Myosin heavy chain, non-muscle Iia
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Myh9 sgRNA CRISPR Lentivector set (Mouse)

K4826201 3 x 1.0 ug
EUR 339

Myh9 sgRNA CRISPR Lentivector set (Rat)

K6807801 3 x 1.0 ug
EUR 339

MYH9 sgRNA CRISPR Lentivector set (Human)

K1374501 3 x 1.0 ug
EUR 339

pcDNA3.1(+)-MYH9(83-764aa)-HA Plasmid

PVTB00946-2a 2 ug
EUR 356

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody (Biotin)

20-abx105692
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody (FITC)

20-abx107109
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody (HRP)

20-abx108530
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody Pair

abx117448-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Myh9 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4826202 1.0 ug DNA
EUR 154

Myh9 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4826203 1.0 ug DNA
EUR 154

Myh9 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4826204 1.0 ug DNA
EUR 154

Myh9 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6807802 1.0 ug DNA
EUR 154

Myh9 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6807803 1.0 ug DNA
EUR 154

Myh9 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6807804 1.0 ug DNA
EUR 154

MYH9 sgRNA CRISPR Lentivector (Human) (Target 1)

K1374502 1.0 ug DNA
EUR 154

MYH9 sgRNA CRISPR Lentivector (Human) (Target 2)

K1374503 1.0 ug DNA
EUR 154

MYH9 sgRNA CRISPR Lentivector (Human) (Target 3)

K1374504 1.0 ug DNA
EUR 154

MYH9 Protein Vector (Mouse) (pPB-C-His)

PV203458 500 ng
EUR 3238

MYH9 Protein Vector (Mouse) (pPB-N-His)

PV203459 500 ng
EUR 3238

MYH9 Protein Vector (Mouse) (pPM-C-HA)

PV203460 500 ng
EUR 3238

MYH9 Protein Vector (Mouse) (pPM-C-His)

PV203461 500 ng
EUR 3238

MYH9 Protein Vector (Rat) (pPB-C-His)

PV283942 500 ng
EUR 3240

MYH9 Protein Vector (Rat) (pPB-N-His)

PV283943 500 ng
EUR 3240

MYH9 Protein Vector (Rat) (pPM-C-HA)

PV283944 500 ng
EUR 3240

MYH9 Protein Vector (Rat) (pPM-C-His)

PV283945 500 ng
EUR 3240

MYH9 Protein Vector (Human) (pPB-C-His)

PV027305 500 ng
EUR 329

MYH9 Protein Vector (Human) (pPB-N-His)

PV027306 500 ng
EUR 329

MYH9 Protein Vector (Human) (pPM-C-HA)

PV027307 500 ng
EUR 329

MYH9 Protein Vector (Human) (pPM-C-His)

PV027308 500 ng
EUR 329

Myh9 3'UTR Luciferase Stable Cell Line

TU113711 1.0 ml Ask for price

Myh9 3'UTR GFP Stable Cell Line

TU163711 1.0 ml Ask for price

Myh9 3'UTR Luciferase Stable Cell Line

TU213631 1.0 ml Ask for price

Myh9 3'UTR GFP Stable Cell Line

TU263631 1.0 ml Ask for price

MYH9 3'UTR GFP Stable Cell Line

TU065040 1.0 ml
EUR 1521

MYH9 3'UTR Luciferase Stable Cell Line

TU015040 1.0 ml
EUR 1521

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

MYH9 Rabbit Polyclonal Antibody