ILF2 Rabbit Polyclonal Antibody

ILF2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

ILF2 Polyclonal Antibody

ABP58929-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ILF2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ILF2 from Human, Mouse, Rat. This ILF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ILF2 protein

ILF2 Polyclonal Antibody

ABP58929-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ILF2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ILF2 from Human, Mouse, Rat. This ILF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ILF2 protein

ILF2 Polyclonal Antibody

ABP58929-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ILF2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ILF2 from Human, Mouse, Rat. This ILF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ILF2 protein

ILF2 Polyclonal Antibody

A52712 100 µg
EUR 570.55
Description: Ask the seller for details

ILF2 Rabbit pAb

A5882-100ul 100 ul
EUR 308

ILF2 Rabbit pAb

A5882-200ul 200 ul
EUR 459

ILF2 Rabbit pAb

A5882-20ul 20 ul
EUR 183

ILF2 Rabbit pAb

A5882-50ul 50 ul
EUR 223

ILF2 Rabbit pAb

A13320-100ul 100 ul
EUR 308

ILF2 Rabbit pAb

A13320-200ul 200 ul
EUR 459

ILF2 Rabbit pAb

A13320-20ul 20 ul
EUR 183

ILF2 Rabbit pAb

A13320-50ul 50 ul
EUR 223

ILF2 antibody

38706-100ul 100ul
EUR 252

ILF2 Antibody

49780-100ul 100ul
EUR 333

ILF2 Antibody

49780-50ul 50ul
EUR 239

ILF2 antibody

10R-3123 100 ug
EUR 407
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAGEB2 antibody, catalog no. 70R-4320

ILF2 antibody

10R-4467 100 ul
EUR 726
Description: Mouse monoclonal ILF2 antibody

ILF2 Antibody

1-CSB-PA00114A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ILF2. Recognizes ILF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

ILF2 Antibody

1-CSB-PA011683GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ILF2. Recognizes ILF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

ILF2 Polyclonal Antibody, Biotin Conjugated

A52709 100 µg
EUR 570.55
Description: reagents widely cited

ILF2 Polyclonal Antibody, FITC Conjugated

A52710 100 µg
EUR 570.55
Description: Ask the seller for details

ILF2 Polyclonal Antibody, HRP Conjugated

A52711 100 µg
EUR 570.55
Description: The best epigenetics products

ILF2 Conjugated Antibody

C38706 100ul
EUR 397

ILF2 Conjugated Antibody

C49780 100ul
EUR 397

ILF2 Antibody (Biotin)

abx430158-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

ILF2 antibody (HRP)

60R-1363 100 ug
EUR 327
Description: Rabbit polyclonal ILF2 antibody (HRP)

ILF2 antibody (FITC)

60R-1364 100 ug
EUR 327
Description: Rabbit polyclonal ILF2 antibody (FITC)

ILF2 antibody (biotin)

60R-1365 100 ug
EUR 327
Description: Rabbit polyclonal ILF2 antibody (biotin)

Anti-ILF2 antibody

STJ28155 100 µl
EUR 277
Description: The protein encoded by this gene is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The encoded 45 kDa protein (NF45, ILF2) forms a complex with the 90 kDa interleukin enhancer-binding factor 3 (NF90, ILF3), and this complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm, to repair DNA breaks by nonhomologous end joining, and to negatively regulate the microRNA processing pathway. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14.

Anti-ILF2 antibody

STJ115284 100 µl
EUR 277
Description: The protein encoded by this gene is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The encoded 45 kDa protein (NF45, ILF2) forms a complex with the 90 kDa interleukin enhancer-binding factor 3 (NF90, ILF3), and this complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm, to repair DNA breaks by nonhomologous end joining, and to negatively regulate the microRNA processing pathway. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14.

Anti-ILF2 antibody

STJ193074 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ILF2

ILF2 siRNA

20-abx902669
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ILF2 siRNA

20-abx920556
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ILF2 siRNA

20-abx920557
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-ILF2

PVT18443 2 ug
EUR 231

anti-ILF2

YF-PA12726 50 ug
EUR 363
Description: Mouse polyclonal to ILF2

anti-ILF2

YF-PA12727 100 ul
EUR 403
Description: Rabbit polyclonal to ILF2

anti-ILF2

YF-PA23991 50 ul
EUR 334
Description: Mouse polyclonal to ILF2

ILF2 Antibody, HRP conjugated

1-CSB-PA00114B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ILF2. Recognizes ILF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ILF2 Antibody, FITC conjugated

1-CSB-PA00114C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ILF2. Recognizes ILF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ILF2 Antibody, Biotin conjugated

1-CSB-PA00114D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ILF2. Recognizes ILF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-ILF2 / NF45 antibody

STJ71178 100 µg
EUR 359

ILF2 cloning plasmid

CSB-CL614262HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atgaggggtgacagaggccgtggtcgtggtgggcgctttggttccagaggaggcccaggaggagggttcaggccctttgtaccacatatcccatttgacttctatttgtgtgaaatggcctttccccgggtcaagccagcacctgatgaaacttccttcagtgaggccttgctga
  • Show more
Description: A cloning plasmid for the ILF2 gene.

pDONR223-ILF2 Plasmid

PVTB01057-1 2 ug
EUR 356

pENTR223-ILF2 vector

PVT12024 2 ug
EUR 308

Anti-ILF2 (1E2)

YF-MA13805 100 ug
EUR 363
Description: Mouse monoclonal to ILF2

Anti-ILF2 / NF45, Biotinylated antibody

STJ73229 100 µg
EUR 359

Mouse ILF2 shRNA Plasmid

20-abx976317
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ILF2 shRNA Plasmid

20-abx989608
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ILF2 ELISA KIT|Human

EF008488 96 Tests
EUR 689

Human ILF2 shRNA Plasmid

20-abx952415
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

20-abx113260
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

20-abx110491
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

20-abx004512
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

abx031364-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

abx031364-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

abx430157-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

ILF2 ORF Vector (Human) (pORF)

ORF005362 1.0 ug DNA
EUR 95

Ilf2 ORF Vector (Rat) (pORF)

ORF068654 1.0 ug DNA
EUR 506

Ilf2 ORF Vector (Mouse) (pORF)

ORF047903 1.0 ug DNA
EUR 506

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody Pair

abx117313-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody (Biotin)

20-abx105027
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody (FITC)

20-abx106440
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody (HRP)

20-abx107856
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ilf2 sgRNA CRISPR Lentivector set (Rat)

K6354201 3 x 1.0 ug
EUR 339

ILF2 sgRNA CRISPR Lentivector set (Human)

K1084001 3 x 1.0 ug
EUR 339

Ilf2 sgRNA CRISPR Lentivector set (Mouse)

K5013101 3 x 1.0 ug
EUR 339

Ilf2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6354202 1.0 ug DNA
EUR 154

Ilf2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6354203 1.0 ug DNA
EUR 154

Ilf2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6354204 1.0 ug DNA
EUR 154

Human Interleukin enhancer-binding factor 2 (ILF2)

1-CSB-RP001144h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 70.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Interleukin enhancer-binding factor 2(ILF2) expressed in E.coli

ILF2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1084002 1.0 ug DNA
EUR 154

ILF2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1084003 1.0 ug DNA
EUR 154

ILF2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1084004 1.0 ug DNA
EUR 154

Ilf2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5013102 1.0 ug DNA
EUR 154

Ilf2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5013103 1.0 ug DNA
EUR 154

Ilf2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5013104 1.0 ug DNA
EUR 154

ILF2 Protein Vector (Human) (pPB-C-His)

PV021445 500 ng
EUR 329

ILF2 Protein Vector (Human) (pPB-N-His)

PV021446 500 ng
EUR 329

ILF2 Protein Vector (Human) (pPM-C-HA)

PV021447 500 ng
EUR 329

ILF2 Protein Vector (Human) (pPM-C-His)

PV021448 500 ng
EUR 329

ILF2 Protein Vector (Rat) (pPB-C-His)

PV274614 500 ng
EUR 603

ILF2 Protein Vector (Rat) (pPB-N-His)

PV274615 500 ng
EUR 603

ILF2 Protein Vector (Rat) (pPM-C-HA)

PV274616 500 ng
EUR 603

ILF2 Protein Vector (Rat) (pPM-C-His)

PV274617 500 ng
EUR 603

ILF2 Protein Vector (Mouse) (pPB-C-His)

PV191610 500 ng
EUR 603

ILF2 Protein Vector (Mouse) (pPB-N-His)

PV191611 500 ng
EUR 603

ILF2 Protein Vector (Mouse) (pPM-C-HA)

PV191612 500 ng
EUR 603

ILF2 Protein Vector (Mouse) (pPM-C-His)

PV191613 500 ng
EUR 603

Ilf2 3'UTR Luciferase Stable Cell Line

TU206268 1.0 ml Ask for price

Ilf2 3'UTR GFP Stable Cell Line

TU160092 1.0 ml Ask for price

ILF2 3'UTR Luciferase Stable Cell Line

TU011116 1.0 ml
EUR 4617

Ilf2 3'UTR Luciferase Stable Cell Line

TU110092 1.0 ml Ask for price

ILF2 3'UTR GFP Stable Cell Line

TU061116 1.0 ml
EUR 4617

Ilf2 3'UTR GFP Stable Cell Line

TU256268 1.0 ml Ask for price

ILF2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV682225 1.0 ug DNA
EUR 682

ILF2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV682229 1.0 ug DNA
EUR 682

ILF2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV682230 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ILF2 Rabbit Polyclonal Antibody